GenePrediction:GLEAN_4460 Details

Name: GLEAN_4460
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:688043..683602 (- strand)
Length: 4442
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:688043..687842 (- strand)
Length: 202
Type: CDS
Source: GLEAN
Position: GCSC_161:687643..687225 (- strand)
Length: 419
Type: CDS
Source: GLEAN
Position: GCSC_161:687180..684315 (- strand)
Length: 2866
Type: CDS
Source: GLEAN
Position: GCSC_161:684254..683602 (- strand)
Length: 653
>GLEAN_4460 class=GenePrediction position=GCSC_161:688043..683602 (- strand)
ATGCCTTCCGAGGCATCACGGGTTCGCTTCGCCTACAGCGACGACGACCGGCCGCGGACCGACAAGGCCAACAAGGGCTA
CCGCCAGCAGCACGGCTTCGTGTCGGACAGCGAGGGGCCAGTGTCGCCAGGCGAGCAGCGCGAGGGCAAGTCGCCGCTGC
TAGGCTCCAACGGCCTGGCCAGCACCCGCCACCGGTCTTCGGGTTCCGGAGGAGGAGGCGGCACCAACGAGACGAGCAAC
ATAGCCAACGGCAGTGTCGGCAACAACAATGGCAGCAGCAGCAGCAGCAACATCAACAACAATAACAACAACGGCAGTAA
CATCAACAGCAACAGCAACAGCATCAACAACACCGGCAATGGCACAGGGGAGCCATGGCCACAACGGCCGACCGGGCCAG
CTCGCACGCTGTCCAACACGTATCAGCCACAGCGACGGCCGACGCCACAGAGCTCATTTCCCGTAATGGGCGGCGGGACG
GACGGACGGACGGCATTGTCGAAGCCGCGGGTGATGACGGGCGGGTCGGCATTTCGGGCACAGGAGCGAGAGTACGTCAA
GCGGCTGCGTGAGAGAGACTACGCATCGGGGTACTTTGACCACCTAAGCGGAACGGTAGACGGACAGTATGCGGACTCGG
ACTCGGAGGGCGAAACGCCATCGTCAGAGGGGCCGCATGACGACCGATACGACCAGGAGGCGATCATGTTCTACAACTAC
GACGACCTTCACCCGACTGAGGAAGACATACGGGACGCATCCAACCGGGAGCGGCTGGAGTGGCACGGGATGCTAGAGGC
CGTGCTGACGGGCGACGTGGTACGGCAGGAGAAGAAGCGGCTGACGGGGGCGGGGCAGAACAGCCGGGCGGCAAGACGGC
ACAGAAGGCAGAGCTGTGGCTGGGAGTGCGGGCACGGATTTGCGGCCGTCACATCCCAGTGCAACGACGGCTGACGGAAG
ACGCGCGGACAAAAGTGGACCGGATGATCGACGAGATCATCAACTTCCGGGTGGAGGGTGTCAGCGACGCGGGCAAGCCG
GCAGCCGAGCAGGTCAGCGAGGTGATAGCGACGATCGACAAGGCCGAGTCGCTGTACCCGACACGAGCAGCGTTTCTGGC
CGCACACAAGACAGCAGCAACGGCTCTGTACGAAGAGTCGTGCGACACGATCGTGTCATGGAGCAACGTGAGCGCGCTGA
TCAACACGGAGCTGGGAATCCTGCGCAAATGGGTGGGCAACGACGAGCTGGACTTTACGCGGGCACGGGACAAGACACCG
GGCAGCGAGGGCAGCCTGTCAGACGACACGTCCTTCCTGGACCGGCTGCTCAAAGAGGAGGGCCTGCGGTCGCTGCACGA
GCACTACGAGGAGGAAGGACGCAGCCGGCGCGGCGGCATGCTGGAGGGCATCTCGCGCACGGTGGTCAAGGCCAAGGAGA
CGCTGGTGCTGCGGGCGACGGCATTCCGGACACGCCACCTGCCGTCACACGTGGAGGACCTGCTGACGCTGATCAGCTTT
CCGTCACGGCTGATGGAAGAGGTGGTGCAGGTGCGGCTGGCATACGCGAAGCGGATGAAGGAGTCGGCACAGCAGAATGT
GATGATGCAGGACCAGATGATTGCGCAGTTCCAGGTGCTGCTGAAGCTGGCGATCAAGATCAAGCAGGAGTACGTGGCGA
TCTCGCAGGCAGAAGCAGGCTGGGAGCTGCCCCCTTGGATCGACGAGAGCTTCGACATGGTGGTGCTGGATGCGCTCAAG
TACTACTTCAAGATGCTGAATTGGAAGCTGAGCAGCAACCGGAACACATTCCGGGAGGCCGAGCTGCTGTTCCAAGAGTG
GGAGTTTGCCAACGAGATCGGCAGCCACCTGGTGCACGGCGACGTGGAGGTGGCCGAGCAGTTCAGCTCGCTGACCTTCA
AGGCGCTGAGCCGGCTGAGCACGACGTTTGAGCGCGAGCTGCAGCGACGGCCGCGTGAGAGCGTGGCGGACATGAGCCGG
CGCTACAAGCAGCTGCTGGACGGCGTGCGAGTGCGACAGCGGATGCTGCAGCGCTTCTCGCGCAGTCTTTCGGACAACTA
CGAGAACGCGTGCGACCTGAATCTGGCGCTGGACGACGACGGGATGGAGCTTTTCCTGGACCGGCTGGCCGAGACAGGCC
ACTTCCAGGTGTACTCGCGGCACCTGGACGAGGAGGGCGTGCTGTTGGTGGCGTCACCGTCGCTGGCCGGCCGTCTGGGT
GCGATCGAGTCGATGATGAGCCGAACGGCATACGAGCAGGTCGAGGACGACCTGGCGAATCCGTATGTGCTCATACTTCG
GCCCGAAGGTGGCGCTGTGTGGTACGGGCCGAGTGTTGAGATACCGGTGCGCGAGGAGCCGCTGGAGCTCAAGACGGGAC
ACCTACGCCTCGTTGCTGGCGGCTCGCAGGTGCGGCTGGTGCTGGCGCGCAAGGCCTTTTTCGAGACGGCCGACGTGCAG
CTCGACCTCGTCATCGAGCAGCGATCGAACCTGAAAAAGGTCCACGCCAAGATGACGGACATCCGACGGACGGCCTACAA
GCTGAGCAACACGTTTATGGACTCGGTCGAGAAGATCCGTCGCCAGACAGCCGGCGAGAACTGCCAGGACCTGATCCAGA
CCTGCTTTGTCTTTGCGACCGAGTTCGGCCAGCGCTCGGCCTCGTACATGGACAGCAACCGACGCCAGATGAGTAATATG
AAGCTGACTAAGCTGGCACTCGACTGGGTCAATTTCATCTGCGTCGACTGCCAGATGTCGGACAAGCGGACCTTCCGCTG
GGCCGTGGTGGCGCTCGAGTTCACGATGAGCATGACGCGCGGCCGCCACATCCTGGGCCTGACCGAGCCCGAGTACGAGC
GACTGCGATACCGCGTCTCGGGCTGCATGTCGCTGCTGATCTCGCACTTTGACGTCATGGGCGCGCGATCGACGGTGGCG
CTGCAGGCCGAGCGCCAGCGCCTCGAGTCATCGCTGTCAGGAGAGTGCGAGGGAGGGACAGCCGTTGGTAGCGGTGGTGT
GGGTGTGGGTGGAGGAAAGAACAAGGCCAACAAGGACATGCCGAACACGAACAAGAGCAGCGCGACGACGAGCCGACAGC
AGCTGCTGCAGCAGCTACAGAACCACCGGCTGCTGGGCGACGAGGAGGCAGCAGCACGGGTGGCAGCGCAGCGGCTGGAT
GGTCTGGCCGTGCTGGACGAACAGCGCAAGGCGCTGCTGACGCAGCGATCGTCGCTCGGGCGCGTGCTGGAGGTGTCGAA
CGAGGTGGACCGGTCGCTGGCCTACCTCTCGTCGACGGCAGCGGCCAATTTCACGATGCGCTGGCAGCAGGGCTACTTTG
TCGGGGGCGGCACGTTTGGCAACGTGTACGCGGCCATGAACCTGGATAACGGACAGGTGATGGCGGTCAAGGAGATCCGG
CTGCAGGACCCGAAGCTGATCCCGACGATCGCGACTCAGATCAGCGACGAGATGCGCGTGCTCGAGTCGCTCGACCACCC
CAACGTCGTGTCGTACTACGGCATCGAGGTTCACCGCGACCGCGTCTACATCTTCATGGAGTACTGCTCGGGCGGATCGC
TTGCCAGCCTGCTGGAACACGGCCGCATCGAGGACGAGCAGGTCATCATGGTGTATGCGCTGCAGCTGCTCGAGGGGCTG
GCCTATCTGCACGAGATCAAGATTGCGCACCGGGACATTAAGCCAGAGAGTGAGTGTGTGTGGGTGGTGTGGTTGTGTTT
TGATTTGTTGTATAATGCTGACTAATCAGACATTCTGCTCGATCACAACGGCATCATCAAGTACGTCGACTTTGGCGCCG
CCAAGGTGATTGCCCGCCACGGCCGCACCTTTGCGTTTGAGTTCAACATGGCCGAGGCGGCGGCAGCGTCGGCAGCAGCA
GCATCAGCATCGGCGCCGTCACCGAGCACGACCGCGGGCACGGCGCCGATCGGCACGAACGCGGTATCGGCCATCACGAC
AGCAGCAGCGGTGGCGGTGGCGGCAGCATCGCGGCCGCCACCCGGCAACGGATCGATGACCGGCACGCCCATGTACATGT
CGCCCGAGGTGATCAAGGGCGAGACGGCCAGCGGGCATTTTGGAGCAATGGACGTCTGGTCGCTCGGCTGCGTCATCCTC
GAGATGGCGACCGGACGGCGGCCGTGGGGCAACCTGGACAACGAGTGGGCGATCATGTACAGCATCGCGCAGGGCAGCCC
GCCGCAGCTGCCGACGGCGGACCAGCTGAGCCCGCAAGGGATCGACTTTCTGCGGTGCTGCTTCCGACGGGACCCGCGGC
AGCGGGCAACGGCGGTGGAGCTGCTGCAGCACGAGTGGATCATGGGGATCCGGAACCTGGTGGTGGAGCCGGCGACACCG
AGCGAGGCGTCGACGCCGTCTGGGAGCACTGCAGGGATATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62