GenePrediction:GLEAN_4462 Details

Name: GLEAN_4462
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:666102..664000 (- strand)
Length: 2103
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:666102..665650 (- strand)
Length: 453
Type: CDS
Source: GLEAN
Position: GCSC_161:665579..665486 (- strand)
Length: 94
Type: CDS
Source: GLEAN
Position: GCSC_161:665430..665231 (- strand)
Length: 200
Type: CDS
Source: GLEAN
Position: GCSC_161:665184..664449 (- strand)
Length: 736
Type: CDS
Source: GLEAN
Position: GCSC_161:664397..664321 (- strand)
Length: 77
Type: CDS
Source: GLEAN
Position: GCSC_161:664263..664000 (- strand)
Length: 264
>GLEAN_4462 class=GenePrediction position=GCSC_161:666102..664000 (- strand)
ATGGAGAGGGGCCGCCATCGGGCTGATGACGGTGGCAGCACGGCAGCTGGCATTGTTGGATCTGGATCCGGACCGGACGC
CTCTTTCGCGGCAGGACGACACCAAGACCGGCACTCTGGCGAGACTGACTCTGGCGAGAGCTACGAACACGAACCTTGGC
TCGAGTTGCTTCCCACCACGGACAGACACCATTCTCACCGACAGCAGCACGCCATGTCTTACAGGCCCCTCGCCTCCGAT
GACCCGGAGGATGCCAAGAGTTACGGCTCGGTCGACTCAGCTGAGACGAGAGGCTCGGCGACTGCAGAAAACCCCTTTTC
CGACGAGGTGACTGCCTCGCACTGGCGCCAGGTATATGAGCGCAGCCAATACGAGTGCCGGCACGCTTTCGACCCCGCGC
TGACCTGGTCGGCTGCTGAGGAGCGTCGGCTGGTCCGCAAGCTGGATGGGCGCGTGTGTTTGTGGGCGGTACGCGGTTTC
CGGCTCCCTGTCAGTTCTTGTGTCTCACCGTCTGACCGTTCAGTGTGTTATGTTCTTTGGTCTGCAAGTCGACCGCGGAA
ACCTGAGCCAGGCCGTATCTGATAACATGTTGGACGATCTGGACCTGAACACGAATGGTAACAACAGCCACATTTGCAGC
AAAGCTAAACTGCCTTCTTACTCATTTCTTAGATTATAACTATGGCCATGCCATATTCCTGCTCTCCTTTCTCTTGGCTG
AGCTGCCATCACAGCTGGTCTCCAAGGCCCTCGGTCCGGATCGCTGGATCCCCATGCAGATGGTCACCTGGTCCCTAGTG
GCCATTTCTCAGTGCGCCATCACCGGACGGAACACCTTCTTTCTAACTCGGAGTCTGCTCGGCCTGCTAGAGGTATGTGT
AACTATATCTATTCTTCTACCTACTTCTAACAACTTAGGGCGGCTTCATTCCCGACCTTGTCCTGTGGCTGTCGTACTTT
TACACCTCCCGAGAGCTGCCCATCCGACTGAGCTACTTCTGGACGACCCTTTCTGTCACGGGGATTGTCACGTCCATCGC
AGCCTCAGGACTGCTGCGCCTTCGTGGCCTAGCCGGCTGGGAGGGTTGGCGCTGGCTCTTCCTGATAGAAGGACAGGTGA
CGCTGCTCGTCGGCGTGGCATCCTTCTTCATGATGCCGGCATCGGCCGTGCAGACCAAGACCTGGTTCCGGCCGCGCGGC
TGGTTTACTGACCGTGAGGTGGCCATCGTCGTGAACCGCGTGCTGCGTGACGACCCATCCAAGGGCGATATGCACAACCG
TGAAGCTCTGACACCGCGTCGCCTGTGGGCTGCCCTCTGCGACTACGACCTGTGGCCACTCTACGCGCTCGGCCTTGTCG
CCTATATACCACAGAACCCCCCCAAGAACTACTTGACCCTCTCCTTGCGTGCCATGGGCTTCGGCACGCTCACCACCAAC
CTGCTGACCATCCCGGCTGACCTTGTCCATATTGCCAATCTCTTGCTGCTGACCTGTCTGTCTGAGCGTTTCAACCAGCG
AGCGTTTGTCGCTATCCTGCAGCCTCTATGGACACTGCCTTGCCTCCTTGCATTGCGCTATTGGCCTGGCATCTCCGTCG
ACCGTTGGGGTACCTATGCTCTGCTCATAGTCCTGCTGTCGTATCCCTACTGTCGTATGTCCCCCCTACGTCCTCTAAGC
TGTCTGATGTGCTGACCGATTTTAGACGCAATTCTCGTCGGTTGGTGCTCCAAAAACTCGAATAATGTCGCTACCCGCAC
TGTTTCGTCGGCCCTATACAACGTAAGATGCGCGGTTCATTGCAGCAGCAGTGAGGGATGACTGCTAACGGTCCTCCAGA
TGAGCACTCAGGCCGGTGGTATCTTTGCCTCCTATGTGTATCGCGAAGACGACAAGCGGCTATATCACCGTGGAAACTCG
ACATTGCTAGTAATCAACGTCTTGTCGATCCTGCTCTTTATCTCAGCCAAGTCGTACTATGTTTGGCGTAACCAGCAGAA
GGAACGCATGTGGAGTACCCTCACGCCAGAACAACAGGCACACTATCGCAAGACCACAAGACTGGAAGGCAGTCGGCGGC
TCGATTTTCGCTTTGCGCACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62