GenePrediction:GLEAN_4463 Details

Name: GLEAN_4463
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:661746..661157 (- strand)
Length: 590
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:661746..661500 (- strand)
Length: 247
Type: CDS
Source: GLEAN
Position: GCSC_161:661374..661157 (- strand)
Length: 218
>GLEAN_4463 class=GenePrediction position=GCSC_161:661746..661157 (- strand)
ATGTACTCCGTAATAGTGAACCTTGCTTGGGCAATCGCATGGGCCGGACGACCCGTACGAGCAGACGGTCTACTGGACCC
TCCAGGACGACAGGGCCGACGCTTTTACGCCGAAATTCTCAACGCGATAGGCATTTCTAAGAACAAGATCGGCTTTGGCC
TGTACACGGATGTGGATTCGTGCTCGGGCTCGGAGAATTGCTGGAACACGGGCTACCGGACGTCACCAATCCTGAGGCGC
TGGCCCAGTCTGGTCTAGACAACAGCAAGGCGCTGGTACTAGCCTTTGTCTCTGCCATCCTCTTCTTCGTGCCCATCACC
GGCGAGCTCGTCGGGGCCGTGGCTTAGGTGAGTGATATTGTGGCCAATATAGACGTGCTCGACGCCGCCGGCAACGCCAC
CATGGACGTCTACACCGTCGTCGATGACCCGGCTAACGCGCCGCTCGCCATTGTCGATCTGATCATGGCGCCGCTGGCTT
TGGCCGACGTGGCGATCGTGGCCAGGGCTGCCGAGCTGAGGCGCGGCATGTCGGCGAAAGACTTGGCCAAGAGCAAGGTG
ACCAAGGGAACAGGCAAGTGTACTGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62