GenePrediction:GLEAN_4465 Details

Name: GLEAN_4465
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:657000..655059 (- strand)
Length: 1942
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:657000..656821 (- strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_161:656754..656647 (- strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_161:656573..655059 (- strand)
Length: 1515
>GLEAN_4465 class=GenePrediction position=GCSC_161:657000..655059 (- strand)
ATGGCATCTCGGCAGATCAGCTTTGCAGCCAGCCTGCGGCTGCTCAACTCGGGCCTTCGGCGGACACAGAAACAGCTGAA
CAGCCAGCTTTCTAGACAGCAACCATGGACATCACGGCAGCAGATTCGCATGTCCAGCTTGGCTGCATTCAAGCCGCCCG
CCGTGCTGAACGAGCCCAACGTCCGTGGTCTTGTCGATAAGCAATGTAACTGCAATTGAGGGCAAATAACTGACGAGGGA
CAACAGCACATCTATGCCAAGGGCTCAGCAGAACGGGCCGGCATCACAGCGGCCATTGAGAACCTGCAGGTCAAGCTGCC
ACTTCAGATTCCGCTCGTTATCGGAGGAAAAGAGGTAGGAGGAGTGAAAACATGCACATACATACATACACACATACACA
CAACCGATACTGACTCCGCGCCTACAGATCCGGACATCATCAGTCGGGAAGCAAGCCAATCCCTCGGATCACAAGTCGAC
TGTGGCCACATACTCACAAGCAAGCCCGGCAGACGTGCGGGCAGCCATCGAGTCGGCGGTGGCAGCACAGGCCGATTGGG
CAGCAACGCCGTTTGCAGAGAGGGCCGCCGTCTTCCTCAAGGCGGCAGACCTGATCGCGAACAAGTACCGGTACGACCTG
ATGGCGGCGACGATGCTGGGCCAGGGCAAGAACGTGTGGCAAGCCGAGATCGACGCGGCAGCAGAGCTGGTGGACTTTCT
GCGCTTCTCTGTGCACCACGCCGAGCAGCTGTACGCACAGCAACCGGTGCACAACTCACCGGGCGTGTGGAACCGCACCG
AGTACCGCCCGCTCGAGGGCTTCGTGTACGCAGTCAGTCCATTCAACTTCACGGCTATTGCCGGCAACCTGACGGGCGCA
CCGGCGCTGCTGGGCAACGTGGTGGTGTGGAAGCCGTCCGACTTTGCGGTGGCGTCCAACTGGGTGCTCTACAACATCTT
CCTCGAGGCCGGCCTGCCGCCCAACGTGATCCAGTTTGTGCCGGGGCCAGCGGCCGAGGTGACGCGCGAGGTGCTGAGCC
ACCCGGCCTTTGCGGCCCTGCACTACACCGGCAGCACGGCCGTGTTCCGGCAGCTCTGGGGCAAGATTGGCGAGGCCATG
GCGGCCGGCAAGTACGCTGCGTACCCGCGGGTCATCGGCGAGACGGGCGGCAAGAACTTCCATCTGGTGCACCGGTCGGC
CGACGTGGCGAACGCAGCCGTGCAGACGGTGCGCGGTGCCTTTGAGTTCCAGGGCCAGAAGTGCAGCGCCACGTCGCGGC
TGTACGCGCCGCGGTCAATCTGGCCACAGCTGCGTGACCGCATCGTCACCGAGGTGGCAGCCCTGCGCCAGGGCGCGCCG
TCCGACCACAGCAACTTTGTCGGCCCGGTGATCCATGCGGACGCCTTCCAGCGGCTGACGAGCGTGATCGATGCCGCGCG
CAACGACCCCGAGCTGACGCTGCTGGCCGGCGGCGCATACGACGGCAGCAAGGGCTACTTTGTGCAGCCGACGGTGTACG
AGACGAGCAACCCAGCACACCCGCTGCTGTCGCGCGAGCTGTTTGGGCCGGTGCTGGTGACACATGTCTACGAGGATGGC
GAGGGCAAGCAGAAGGAGGAGCAGGACGCCGCCTTTGCTGCGGCCTGCGACCTCGTCAGCACGACGTCCGAGTACGGCCT
GACGGGCTCTGTGTTTGCGGCTGACCGGGCTGCTGTGCGCGTGGCTGAAGAGCGGCTGCGCAATGCAGCCGGCAACTTTT
ACATCAACTGCAAGAGCACGGGCGCTGTCGTGGGCCAGCAGCCGTTTGGCGGCAGCCGTGCTAGCGGGACCAACGACAAG
GCCGGCAGTGCCACGCTGCTGAACCGGTTTGTCAGCGTGCGCAGCATCAAGGAGGAGTTTGGATCGACGACGACGGTAGC
ATATCCGAGTAACGAGGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62