GenePrediction:GLEAN_4466 Details

Name: GLEAN_4466
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:654037..650036 (- strand)
Length: 4002
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:654037..652633 (- strand)
Length: 1405
Type: CDS
Source: GLEAN
Position: GCSC_161:651856..651390 (- strand)
Length: 467
Type: CDS
Source: GLEAN
Position: GCSC_161:650838..650609 (- strand)
Length: 230
Type: CDS
Source: GLEAN
Position: GCSC_161:650180..650036 (- strand)
Length: 145
>GLEAN_4466 class=GenePrediction position=GCSC_161:654037..650036 (- strand)
ATGCCTCCTTCTGCTCTCCCTCCGACGCCAGCGTCTTCGACCGATATCAAGGGCCAAGACGGATCCAAGCATCTGGCCGC
CCTGCAGACGTCCTTTGAACTGCCCCCACCAGCTCTGGCTGCTGCGAGCGGCGACGCATCTTCACCAGCAGCATCGCCCA
CCGATGCGACCGTACACCCGTCTGCCGACATGGAAAAGATGTCGCCGCCCGTCGTCCCGGAATATCCCGTGCAGGCCGCC
GAGGCCGTCAAGTCCCGCCGCAGATCGGCAGCAGCAGCGGCTGCCAAGAACGCCTTTGCCCTGCCACCGCCGCCCACTCG
ATCCCGGAAGATCATACAGATGAAGCCGCGTTCGGCTTCCATAACGGGTGGTGTTGGGATTTCTGCCGTCCCGCCAGAGG
AGTTGCGAGCGGCAGAGACGAGCAGCAGTGCTGCGACAGTGACGGGAGCTGGTGCTGCTGCCACTCCTACCACTGCTTCT
ACGGCTACTGCAGCTGCTGCAGCCACTGTCACTGCTACTACAGCTGTGACCACCTCGGCAACGGCTGCAGCCAACAAGAG
GAAGCCGCCGTCATCTACCAGTGCCGCCGGCCGCAAGATTGCACGCAAGACGGCCCACAGCCTCATCGAGAGACGGCGAC
GGTCCAAGATGAACGAGGAGTTTGCCGTGCTCAAGAACATGATCCCCGCGTGCACGGGCGAGATGCACAAGCTGGCCATT
CTCCAGGCCTCCATCGAGTACGTCCGCTACCTGGAAGACTGTGTGGCCTCGCTCAAGGCCCATCATGAGGGCGGGAAGCA
GCAGCAACAGCAACAACTCCATACGTCCTCGTCTCCCGTTCGCAGCCAGTACGATCCGGCTCATCACTACCCGACAGCCT
CCAAGGAGGAATCCACGTCGCCTGACGTCGAGATGGATGATGCCATTGGCCAAGATGCCGCCTACGACGATGGCTTAGAA
GGCGATGACGGCGATGACGTTGACGTAAACCTGTCGTCACCTACTTGGGATGCCACCCAGCCGTCGTCATCACATTCCAC
AGTGCACCAGCCGTCCGTCTCGCCTGTTTTGCTGGCCCAGGACGCGCAACGTCGCCCCCAACGTCAGGACTCGCTGTCAT
CTACTGCCTCTGTGTCGGCAGCAGCCGCTGCAGCGGAAGCCGCGGCTATCGAGCACCACCGGCACTACAGCTGCAGCGCA
TCCACGCAGGCGTCGCCGGCGTTTGGCCCTCAACCTTCTTACCTGTATTCTGCCACCACCGCCTCAGTGGCTGGTCTGAC
GTTGACGAGCCCGGCTCTGCTGCCGCAGCGGGACTTGGACCAGGAAGCAACAGCAGCTCTGCTGATGCTAAACAGCGATC
GGCGTGGATCAGTAGTCAGCAACGGCAATAACGCGTCCAGCCGGGGTATGAGCGTTCGGGATCTGCTCAGTACATGAAGG
AAACTGGAATGCTATGACCAGGGAGCCTCCTTGGCCCCAGAAGTCAGGCTTATGAGACAGTTGAATGAAAGAGCCAGACG
AGAACGTCAGCTCGAGCATTTGCTCACGCGTGTGTCCCACACATTTCACGCCACCTGTTGAGTCACCCGAGCCAGCCCGT
GACAGATAGGCCAGGAACAAGCGCTGCGTCGTGCCCTAACCCTGTTATCAGCGGATGACGAATTTGCTAGCTGCATAGGC
GGGATACTAGCTTCTAAAAGAAGCTGGATACCTTATGTACGGCTGATTATAGGAATGGTTTCCGTATACGCCTGCATTGT
TGTGTCTTTAGCTTCACCTAAGCTAGCTTCATAATTTAGGAACTAATTGTGCCCTTTTAACCTTAACTCTCCCGTCCCTC
CTTTTCTACTTTGTTTTTTGTAAATTCTTTTGATAGCACAACCTTGATTAGTTCTTATCCAAAACTTTGGTAGCTATTTG
CCATAGGCTTACTATGTGACAAGTTGATCTAAAAGAACCATGCCTATTTATATTATTTACATTCCTTTTCTCTCTCTCGT
GTATACTTTATAATCTTAGGACCTACTAATTCAAACAAACAAAGTGAACAACAATACAATGGTTCTGGCACGCCTATTAG
ACACTAATACTATTATGGTTATAGTTTTTCAATTTTTGAAAAACAAAGGCAAGCCTAAACACACCCCTAAGAACCCATAT
TACGAACGAGTTCCGAGACAGCAAGTGTCTCTGATGTGAGCCGCAACAGCACCGTCCTAGATGACCTGTCATCATACCAG
GACGTGTTTAGCTTGGACCAACAGGTGAAATCGATCGTGGAGGACGAGTCCATGTTCGGCACGGTAGAGGGACAGATAAA
CCTGGACTTCGCCAAGCCTGATGTCGTTAAATTGATTATTCGTGTGGCTGTTGTGCTGACAGCCAAATTCGCGAATCCAA
CCACGCGAAGATCTCGGGAATCGATGGAAGCAGCTGAGAGAATGGGGAAAGTCATTGCGGCGGTCGCTATGACAGCCGCT
GATCTTACAAACGAAACTCCGACCGCCTCGGCATTCTTCTGTGCGTACGCCGTCACCAGGGCGGCCGTGATTTCTGTCAG
CGTCCGGGATTCCAGCGTACCTCCGATTACGGCACATGCAGTTGGCAATGCGGCGCTACAGGCTGACTACTTGCGCCACT
GCTTCAAAGTAGGGGGAAATGCACGAGATCTAAACACCAAACTCGTGAAAGAGGCAAACGCCTGTGCACACGACTTGATC
ATGGCCTGCCAAAGTTTATGGGATGTACGGTGTTACATGTCCTCGGCATTGTTCTCGTCCGAGTTGCCAAAGCCGTGGTA
GTGGATCCTGGAAATCGAAGAGAAGCGGCCATAATGTTTAGCGAGTATGCGACAAATACAAAAGGAATATTTGGACATCG
GGAACCACTATAGGTTCTTTGATTTTATTTAGGGGTGGCCGATTCTGTGAGAATAACGCGTCCCTTCTTGATTCTTGCAA
GTCGATTATGCGACTCGGTCCTTCTCTTTTCAGATGAATCGCCAAGACGCGTCGTTTAGCCAGCTCGTTCTTTCCTGTTT
CGAATCAAAATTGCGTACGAAAAAATGGTATGATTTCATCTAAATCAGCAATTTCTCTCTCTTCTCGTTTCTTTCTCCTT
TTTCATTCTCTTCTCTCTCTCTATATCCCTCTCTATATTCCTATCTCCAAATCTCTTTCCCCTATTTGTTGCAGACCAGA
CAGACAGCAGCAGATGTGGTGAGGGCCGCGGCATCTTTGGCACTTTCGGCGGCAGACATGACAGGTGCGGCAGTAAGGGC
AGAGGCGATGACCGCCCCGTGCATTTCCCAGACCGTCTGGAGACCGTGACGGTGGCGACAATGACTGTCACAGAGACAGT
GACGGTGACGACGGCAGCAGCAGCAAACGGCCGAGCCGTGCAAGACTTCACTAATGTAGTCGAAAACGTGTCAAGTTTTG
CTGATATGGAATTGCCCCGGTTTCCAGACGTCTGGGCGACTGCATTAGTGGGGGTAGTGACAGTATGGAGGAAGGGGATC
ACCGAGTCGGTGAAGTCCGCGTGGACGGCGTCGGTTATTGAGATGGAGGAGGGGAGGGAGGAGGAGGGGAGGGAGGAGGA
GGGGAGGGAGGAGGAGGGGAGGGAGGAGGAGGGGAGGAAGGCCTCTAGCAATACTTCGGCGACAAATTCCGCAGTTCAAA
TCTTCCTACGTCTTATTTCAACTATAACCCAGCTTTTTCTAGAGACTAATGACTATTACTTTGCTTCTGTCAGCATACCA
TAGGAAGCTGTTCTAACGATTTGAATCCATAACCACATTCAGCTCATGTTCAGCTAGCGGGTCTCGTTCAGCTAGGCAAC
TAATGCAAAAGCCTCAGTCGAATTCTAAGGAAGGAGAGGCTCGGTAACGACAACATCAGACAGATCCGAGCAGAGACAAA
ACTCAACGAGGATATTTCTACCGGCATTCTAGACGCGGAGTTCGCCAAAATGCTAATCAACACTGAACATCACGGCTACT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62