GenePrediction:GLEAN_4468 Details

Name: GLEAN_4468
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:585799..582468 (- strand)
Length: 3332
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:585799..585457 (- strand)
Length: 343
Type: CDS
Source: GLEAN
Position: GCSC_161:584964..584157 (- strand)
Length: 808
Type: CDS
Source: GLEAN
Position: GCSC_161:584088..582468 (- strand)
Length: 1621
>GLEAN_4468 class=GenePrediction position=GCSC_161:585799..582468 (- strand)
ATGGATCACCTACGGCGCGAATACAACTCGGACAGAGGCGCTAAGAAGCAAAGCTATGCGTTGACAATAACGGGCACGTT
GGGGATCATGGCTGGCACTTTCATTTGCGCAGCAATAGTTGAGGCAGGCACAAAGGAAGAAGTCTGGCGGGCTGCAGATC
CAGAGGCCATGCCTATCCATGTCATGTGGCTACAAAGAGGGAAGAATGTTGGCGATCAAGCGTTCGATTCCTATGCCATT
TACGGTACGAAGGGAGAGCAAAAGATACGCGTCTCGCGGAAATCCAACAATACCACGCATCTCGAGCTTTGGACTCTGGT
CGGATCATCGTTGACGGTCGTCAGTAAGTCCAGCCCCAAGTTTTGGGTTCTCTGTAATCTTCTGGTACTTTCCGTTTAAC
AACCGATGCAGGCTTCGTCCTACAATTCGTTGGGTACGGTCGTCGCAGCTGGCGCAATCCTCTTTCCTCTTCTTCATCGA
TGTTCTGACGGGTAGACAGACTCCGAGGGATGCCTTGGCCGGCGTCGGTTGCACAACTAGTTGCGACCGCTGTTATGACC
GTGACTAGGCTCTGGCTATACAACCGAATTTCCACGGTTCCAGAAAGCGAGAGGCTTCCCTCTGGACATGAACTGGACGC
AGTAGCAAAGAAGATAAACGACTGCAAAAATTGGGAGGTCCTCCCACCACGCCCATATGCGAACTTGGATTCCATGACCT
CTCCCGTGTTTGAAAAAAAAGAGGGAGAAAAAAGTGTCGACTTGCCGTCATATCTATCTTGCGTCTCAAGTACTGAAGAC
ACGTATCAGACTAACGCAAATATCCGGGTGGTCAGATAGCTTTGTTGCCGAGGCCGACCAGCTTTCCAACGCAATAGAAA
CGATTTTGAACCACTTGTACCGACCCAATGGCGATGTTGTCATCAAAACGTTTCTCCAAAATCAAGAAAAGTTTGAATTG
ACGCTGGGTGTGTCTGTCTCTAAGGAGGGCAGCTGTGGCCCGACAGCCGGTGACGTGGGCGTCTCATTCACAAGGAAACG
GTCAGATGACACGTGGACACCCTGGAAGGCGGACAACGAAAAGATTAGGGCGGTGCTATCGCTCTGGCTATCATACTTTA
GCCAGCCGGGAAGCTCAGCACAGCAGGAGAAGAAGAACCTGTGGGTCATTGGCCCCGACGACGATTTGACTGATATTCTC
TACGACTGGTGGATTTATCGCGGGACAGAAAAGCGGCGGCAGGACAGTTTCGAGTTGGATCCCCGGCTCAGATCCGTCGT
TGGTGACCGCGTATTTGATTTACGGTGCAGGCCGGACGTGATGGGACGAGTCGACGGCAGCACGGGCCAGATCAGCATTC
TGACCAGTGACAGCCTACCCAGAGCGTGCAGCCAGTACCTCTTGGGCTGTTTTCTAAAGTCCGTCATCGGATGTGTGGAG
AAACTGAACGGGAAGACGAGCGTGGCACCAGGTGTGACCTCGGGCGAAATCCATCTGATGAACGACTCGGTCCAATTACT
GGCCGAGACGTTGCATCAAGGCGGTGGCGGTATAGTTTCGTTAGAGGATGCACACAGACTGTTGGTGCCTTCACTGAGTG
ACGCCGGCCTTCTCCCGGATGCCCTCGACGTTCTGGAGGATAAGTGGCCGTCGCGAAGGAGGATGAAAAGAGCAGCACAG
TCTGCATGCGTCTTCTCTACCTGTGCGAGAGAAAGGCGAAGCTGCAGAGCGAACAGGACCGTTGGGCCGGGACGGGGGCA
ACGTTCAGGAAGCTGATCGACACGTTTTCCGATGCCTTGGGGCCCTATGCGCCAGAGACGGCGCGCGCGACTGACGCTAT
GCAGGCATTTGCCGCAGACTTTATAGACTGGAGAACGACAGCGTCGGCCAGGCAGAAGGACCGCCTCCGAAGTCTCGACG
AGCTGTTCTGGCTGCACGCGGCATCGAGACACGGCTTGATCGGACAGGTGCTCCAGGGAGTCTTGGACGGACTGGGCGTG
GACACGTGGGACGATGAGCACGAGACGCCCATCAGCCTTGTCGATCAAGCACGGACACCTGGACATCACTCGGCTGGTCA
TGTTCTTTGGTGCGCCCGTGGACCACCAGCTGGTCTCATGGCGATCGAGCATATGGGCCAGACTCTGCAGGCGGAGGCCA
ACCAGATGATCCTGCGGCTGTTGCTGCTCAATTTCCGGGACGAGGACAATGTGTTGCTGGAGGCCTGCATGACCGGACAC
GGAAACACGGCCTTTCTGATCGACATTCTGCTCGAGTCGGGCATCGACGCAACGGCGAAGAACAAGGACGGGCTGACGCC
GGTGCATATCGCCTCGAATCGGGGCAAGGAGCGGGTTGTCCAGGCCCTTCTGGAGAAGAAAGTCGATCTGGAAGCACAGA
CGCCTTTGAAACAAACAGCTCTGCATCTGGCCGTGCTGGGGCGACACGAGTCTGTCGTCGGCCTTGTCCTGCACGCGGGC
TCAAGCAAGGACGCTCGGGACAGCAAGAAGAGGACGTGTCTGCATCTGGCCGCAGAAGAGGGGCAGCTGGACATGGCCAG
GCTGCTGGTGAAGCACGGGTTCGACGTCAATGCCCGAGACGAGTCCGGCCGGACGATGCTTCACATCAGTGTCACGAACA
GCGACGCCGAGATGGTGCAGTGGTTGCTGAGCCGCGGCGGCGTGGACGTGACCGCCAAGGACAACGACCAGAGCACGGCT
CTCCACCAAGCCTCTCGGCTAGGCAGCGGCACGATCGCACAGATGATGGTGGAACAGGCAGCCGGCCGGACCCTGCTGCA
GGCCCGGGACAAGTACGGCTCGACGCCCTTTGTCATTGCCGGCCGTGAGGACGGGCGCGAGGCCGTGCTGCGAACGATGG
CTGAGCATGGAGCCCGGATGGATGCCCGGGAAGAAGCCGGCCAAGGGGCGCTCGAATACGCTGCACTCATGGGCCACCTC
GAAGCCGTGCGCTTTCTGGTCGGCAGAGACGTCACGGCACGGCACCGCGATGGCTTCAAACGCACAGCGCTGCACTATGC
GGCGTGGTGCAAGAATACCCACAGCATGGCCATTGCTGTCCTGCTGCTGGCACATGATGCTGCCGTCAACGCGGCCGACA
AGGACGGCTGGACCGCTCTGCATTACGCATGTTGCGTTCAGAAGGAGGAGATGGTGGCCTTGTTGCTGGCCAGCGGCGCT
GATGCGACACGAGAGGACCGCTTGGGCCGGACGGCCAGATCGTACCAAGAGGGGGAGATCGAGATCAATTTCTGGACAAG
AGCACTTCCGCCGCCGTATCCACCCATGGATATATTTGCTGACTCATTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62