GenePrediction:GLEAN_4469 Details

Name: GLEAN_4469
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:581733..580027 (- strand)
Length: 1707
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:581733..581727 (- strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_161:581609..580027 (- strand)
Length: 1583
>GLEAN_4469 class=GenePrediction position=GCSC_161:581733..580027 (- strand)
ATGGGCGGTACGTGTGGTTTGTGATTTTCAAATTAAAAGTCACTAAGCTAATAGATAGGCCAAGCATCGAAGTCTTCCCG
GAAGGAAGGCAGCGACGAAACCACGTTTTCTGGAAGTACATTAGTCGAAAGCGATCCAGGAACGGTTCCCACGACGAGCC
CAGACAAGAAACAAATCCTGCCCTTTCTTTGTCCCCCTTCTGATGAAGAAGCACGACAGTATTACTTTGGTCTACCATCG
TTTCCGCGCCTTGTCGGTCGTGCTTCTGCTGGAATAGAGCGATGGGAGACATTCAAAGAGCAGTATACTCGGCAGAAACA
CGTCAGTCACAAAAGACCTGCAGAGAAGGTGCTTAGTGCAGTTGGCGCCCACAAAATCCTGGTCTGTTGGAAAGACGTGC
GTCCCGACATCCTCACGGCCATAGACCGCCTCCCTTGGTCGTCAGTGGACGTATGCCGCATCGGTTTCTCGGCCGCAGCT
CCCTCGGAGCGGCCCATCGTTGTGTGGGTCGGCATCAATGGGGATTCCACAAAATCATGCGATCTGCCGTGGGAGGATGT
TGCGGAGGCGTTTCGTTCGTGCCGGCAGATCCTCGATCACGCGGGCTTGGACGACGTCGATTGCCAGCTTCGCATCTCCA
GAGTGATCTCGCTGGCGGGCCCACGGCTGCTGAAGCCTCTTCCCATGGTATACGGCCCGTGGCACTACATCGGTCAAAGA
TTCACGGCGTCTATCGGCTTGTCATTCTCCCCGCTCGAACGGCCCACACTAGAGGGCTCACTGGGAGTGTTTCTGACCAC
CGAAAGTAAGACGGCTGGAGACGGACCGCTACTGGCGGTCACTTGCCGCCATGTCGGAATCCCGAGCAAAGACAACCCCG
ACAATGCCTACTTTCGGTTTCAAGATGACGGCAAGAAGCGCGCAGTGGGCCTTAGTGTGCAGAGCAAGGCGAAAGAATGG
ATCAAGGAACTGTCCGACCTCAAAAATACGACAGCTGGAAGCGCAGTGGGAGCAGAGGTGACCGAATTCTACGAAGCCGT
CAAAGTTTTTGGGTCCGACGACGCCCGGAAGATCGGGCATGTGATTTTGTCTCCGCCCATCGGCCTGCAGCAGACGGCGG
CCACTTGGACACGGGATTGGTGTCTGCTGGAGCTCGACCAGAGCAAGTTTCTGGGCGGCGAAAAGCCCGTCAATGTTGTG
GATCTCCGCACGTACATGGCACCCTCAGCCGTGAACGAGCTGCTCAACTCCCATGTACGAGACGAGAAGAGGTTCGAGTT
CCCCGACAATGGACTCCTTCGTCTCCCCGGCGTCATTCCATTGGCCGAGATTCGAAATCCGACCATGTGTGACAAAGATG
GCGAGAACTGCATCATAGTCGGGAAGCGGGGAGCAATCTCCGGCTTGACCTGGGGCGCTGCTTTGGATTTGGAGTCGACG
GTGCGGGATTGCATGCCCGACGGAAGTATATTCACATCATACGAGTGGGCCATTCACGGCTCGCTTCCGAAAAAGACGGT
TCCTTTCAGCGGAGCTGGCGATTCGGGAGCGGCTGTGTTTGATCTTCAAGGACGTCTGGGCGGATTTGTGACTAGGGGCA
CGAAAACGGATCTCGGGCTGGACGTGGATATCACATATGCTACGCCGGCAGAGCTTGGCCTTGCCGATATCGAAAAGGAG
CATGGACAGAAGGTCGTTCTTCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62