GenePrediction:GLEAN_4470 Details

Name: GLEAN_4470
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:579539..577141 (- strand)
Length: 2399
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:579539..579199 (- strand)
Length: 341
Type: CDS
Source: GLEAN
Position: GCSC_161:579147..577946 (- strand)
Length: 1202
Type: CDS
Source: GLEAN
Position: GCSC_161:577898..577750 (- strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_161:577668..577141 (- strand)
Length: 528
>GLEAN_4470 class=GenePrediction position=GCSC_161:579539..577141 (- strand)
ATGCGTCTGCACACGTTTGCAGTTCTGTCTTTGGCCGCTGGTCATGGGCTATCGGCGGCGGTCGGCCCGACCGAAGACGA
AGCATCACAGCGAGTGCTCAGCAGCAGCAGCTCATTCGAATGCGATGTCCCGCCGGCAGTCTCGCCTGATTCTGACGGCC
TGCCCTCGGCGGACGAGCTCTTCTCGGGCCCGGAGGCACTCCAGAAGCAGGTTGAGCGGCACGGGGCCCTGGTGCGGATT
CCGTCGATCAGCTACGACGACATGGCAGACGTGAACGAGGATCCGCGCTGGGACGTATTTCTGGACGTGCACCGGCTGCT
GGAGGAACTGTATCCGGCGGTGTATGTTTAATGTCTCCAGGTCTACAGCTGCTAGCGCCGCTAACCGGATAGACACGCGC
GGATGAACCGGACCAAGGTCAACCGGCTGGGGCTGGTGTACACGATCGCGGGCAGTGATCCATCACTGCGGCCGGTGATG
CTGACGGCGCACCAAGACGTGGTGCCGGTGGCAGACGGGTCGACGTGGACGCACGCGCCCTTTTCGGGGCACTTTGACGG
CACGATGCTATGGGGTCGGGGGGCATACGACGACAAGAACAGCCTGACAGCGCTGATGTCGGCGCTGGAGGCATTGTTCC
TGACCAAGACCGGCTGGACGCCACGACGTGGGCTCGTGCTGGCGCTGGGCTTCGACGAGGAGACGTCGGGACAGCGCGGC
GCCGGCACGATGGCGCCGTACCTCGAAAGACGCTTCGGACGCGACTCGATGGCGCTGCTGCTGGACGAGGGCAGTGCTGG
CTTGGAGCGGCTCGGCGACGTCGTGTTTGCGCTACCATCGGTGCTCGAGAAGGGGCATGTGGACGTGCTGTACGAGCTCC
GGGTGGCGGGCGGACACTCGTCAATGCCGTTTCCACACACGGGCATCGGGATCGCGGCCGAGATGGTGGCGGCGTTGGAG
CAGAACCCATACGCGCCGGCCATCCTGCCGGGCTCGCCGCTGCACCAGAGCTACTGCTGCAAGGCACGGTATGCACCAGA
GGCCAACCCTGAGATCACGCGGCTCATACGGCAAGACCGGCTCGACGAGCTCGCCACACTGCTCGCGGCCATCGACCGGC
CGACCAACTTCCGGCTGCAGACATCACAGTCGGTCGATCTCATCGCGGGCGGCGTCAAGATCAACGCGATGCCCGAGGTG
GTGCGGCTTGGGGTCAACTACCGGGTGGCCACACACGAGTCGATCGACGCGGTCAAGCGCAAGACAGTGCAACTGATGCG
GCCGATTGCGGAAAAGTACGGCCTCACGCTCGAGGCGTTCAAGGACAGCGGGTTCGGCGAGGCCGAGGACACTGTCGACT
CGAACGTGGTGGTCCTTCTGGACGCGGTGAAACCCCTATACCAAGTCGACTATAACGGCACGTTGCGACTCACAACAGAT
CAGGAGACCCAACCGGCTCCTGTCTCACCGACAACAGGTCCGGTCTGGGATCTCTTTTCCGGCACGATCCAGCACACGTT
CGCCTTTGAGGGCGGCAAGGTGGTGCCAGCGGGCGACCTGATGAACGGGAACACGGACACGCGGCATTATTTGAGTACGT
CTTTTGCGCCTGTCACGTTAAGGAAAGATTCTAACGTCTAGACCTCACACGCAACATTTACCGATGGCTGCCAATGATGG
AAAACGCAGGCATGAACCCGCACACAGTCGACGAGGGCATCGACATGCACGCCCACATGGGGGTCATCAGGTTCTATTAC
AATCTGATCCGCAACTTTGATGCATCGGATGTCTGAGAAAATTGTGTAGTATCTAGCAGATCGCTTCTATATCATACATC
CTTCATTCGTACCACCACACAATTGCTCCAGCCACCAGGCGTGAATGCGCGTGTCGTCGGTGAGTTCGGGGTGGAAGCTC
GTGCCAAAGATATTGTCCTGTTGGACAGCCACGATGTCGCCATTGACGCGGCCAAGCACACGAACCGGATGGTGGCCATG
ACCGGGATCGAGCAGCTCGGACACGACGGGGGCGCGGATGAAGACGGCGTGGAAGAGATCCTTCAAAAAGGGCAGTTCGA
CGTCAGCCTCGAAGCTGTTGATCTGGCGGCCAAAATGGTTGCGGTGGACACAGACGTCGAGGCCGCCAATATGCTGCTGG
CCGCCTTCTTTGGCTGCGTCGACCCGTTCGGCCAGGAGGATGAGACCAGCACAGGTGCCCCAGGTGGGTTTTTTGGCGCC
GACAAACTGGCGCAGCCCATCCATCAGGCCAGAGCGCGTGGCCACGAGCGCGAGCGTGGTGCTCTCGCCGCCTGGAATGA
CGAGGCCGTCACAACGTCCCAATTCGTCAACCGTGCGAACCTGCACAAAGTCAAACGAGCGCAAGGCCAGGCCAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62