GenePrediction:GLEAN_4473 Details

Name: GLEAN_4473
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:566326..563428 (- strand)
Length: 2899
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:566326..566174 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_161:566114..565966 (- strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_161:565901..564737 (- strand)
Length: 1165
Type: CDS
Source: GLEAN
Position: GCSC_161:564516..563524 (- strand)
Length: 993
Type: CDS
Source: GLEAN
Position: GCSC_161:563445..563428 (- strand)
Length: 18
>GLEAN_4473 class=GenePrediction position=GCSC_161:566326..563428 (- strand)
ATGAGTGCGGTCAACGGCCAGTTCGGCCAGCCTCCGCCGGCCGCAAGTGCGTGGCAGGAATATCGCAGTGCTGATGGACG
CGTCTATTACTACAATGCGATGACCAAGGTCACGCAGTGGACGAAGCCGGAGGACATGATGAGTCCGGGAGAGGTGAGTT
CATTCTCTTGGAGCTTTAGGTAGTGTGGCTTGCTAACAAACTCAAACTACAGCGCGCTCTCCTGAATCAGCCATGGAAGG
AATACACGGCCGAAGGAGGCAGAAAGTATTGGTACAACACAGAGACGAAACAGAGCTCGTGGGAGATGCCAGAGGCCTAC
AGAAAGGCTCTGGGACCGGCGACGACGCCGACGACGCCAGCGTATGTTGAGTCTGACCCTCTCAGTATGAAACATGTGCA
ATGGTACTGACAAGCTCTTTTGAAGAACGCCTGTTTCCATTCCGACTGGGCCTGCAGCAGGATATGGTGGTGGCGACAAC
AATCACGACCACGGTCATGGCCACGGCCACGGCTATGGACAGCGTGACCTGCGCGACGGCGCAGTGCCCGAGTCACGCCA
GCTGGCCTACAGCAGCTTCAGCGATCAACAGCAGCAGCAGCAGCAACGGGCGGCAGCGCTGGTGCCGACCGGCGGCGAGG
CCGAGCCGCAGACAGAGCAGGCGAGCGCAGAGGAGGCCGAAGCAACATTTGTCAAGGCGCTGCGGCGCAACGGGGTGCAG
CCGGAGTGGACGTGGGAGCAGACGCTGCGAGCGATCGTGCGCGACCCGCAGTACCGGGCGATCCAAGACCCACGCGACCG
CAAGGCAGCCTTTGAGCGGTACTGCCAGGACGTGGTGGCACAGGACAAGGAGCGGGCCCGCGAGAGGCTGAACAAGCTAC
GTGCCGACTTTGCAACGATGCTGAAGAGCCACCCCGAGATCGGGCACTATACTCACTGGCGGACAGCGCGGCCGATGATC
GAGGGCGAGACCATCTTCCGGTCGACGAGCAGCGAGAGCGAGCGGCGGCAGCTGTTTGACGACTATGTGGCCGACCTACG
GCGCAGCCACCGGGAACAGCGGGCGGCGGCACGCAAGACGGCCATGGACGGACTCGTCGAACTGCTGCCGCAGCTGCACC
TGGAGCCCTATACGCGCTGGGCCGATGCGCGGCCGCTGATCGAGGCGGCACCACTGGTGCAGAAGCACCTGCACCCCGGG
GACGAGGGCGAGGGCGAGGGCGAGGGCGAGGGCGTTGACAGGTACCCATCCATCAGCCAGTATGACGTCCTGACCGTGTT
CCAAAACCACATCAAGGGGCTCGAGCGCACCTTGAACGACCAGAAGCAGGAGGAGAAGCAGCAGAAGCAGCGGGTCGAGC
GCAAGAACCGCGAGGCCTTTGTCGCCCTGCTTGGCGACCTCAGGAGGGACGGCAAGATCAAGGCCGGCAGCAAGTGGTCC
AACATCTTTCCCCTCCTCGAGACCGACGAGCGCTACCGCGCCATGGTCGGCCAGAGCGGCTCCTCGCCTCAGGAGCTCTT
CTGGGATCTCGTCGACGAGGAGCAGCGCGCTCTTCGTGGCACGCGCAACGACGTCGAGGATGTCATTGATGTGAGTGTCT
GTCTGCTGTTCGGGTGGCCCGACTCCTGCTAACCAGCCAGGACAAACGCTTTGAGGTCACACCCAAAACCACGTTCGAAA
GCTTCCTTGCAGTTATGAGAGACGATCGTCGTACTGCTAACATTGACCGAGAGGTTCTCGCGCTGATTTTTGAGCGTGTA
CGTCTGGCACTCGTCCACTTCCACTGCGACCCGTCCGCTAACTCTCCCAGCTGCAAGAGAAGAAGAAAGAGAAACGGTCG
GACGAGGACCGCCAGGCCGAGCGGCAGCAGCGCCGCGCCCTCGACGAGTTCCGCGCGTTCCTGAAGCGAATGCACCCGGC
GCTCACCGCCAGCGATACATACGAGAAGGTGAAGCCCCGTCTCCAAAAGGCTGAAGAATACCAGGCGGTCAGCTCGGAAG
AAGCGCGACAGGGCGCCGTCGAGAAGTACCTCCGCCGTCTGCACGACAAGGAGGAAGAGGCCGATCGGGACCGACAGCGA
CGGCGCGATCGGGTCGAGGAACGAGGCAGCACCTCGCACCGCGACCGAGACAGAGGTGAGCGACCGCCCCGCAGTGCAGC
TGGAGCCGGAACTGGAGCCGGAGCCGGAGCAGTGCCCCGGACAGGTGGCAGGTCACGGTCACCAGAGACAGACATGTACG
AAGCAGACCGGCGTCGAGCGATGGCTGAGCGGGAGCGAAACCACCGGAAGCCGAGCGTCTCGGAGGGCGTCAACGACGAT
CGCCGATCGGTCGACTCGCGTGAGTATCGAGACCGTGATCGAGACCGGGATCGGGAGCGGGAGCGAGACCGGGTCCGAGA
ACGAGAACGGGACCGAGACCGGGAACGAGACCGAGACCGATTCCGGGACCGAGATCGTGAACGGGATCGTGAACGGGATC
GCGATCGGGAACGAGACCGGGAACGAGACCGGGGAGGACGGGATCGTAGCGAACGGCCCCGAGACCGAGACCGGGACCGG
GATCGCGATCAGCGGGACCGCGTGCGTGATGACGATGATCGGCCGCCTCGCATGTCACGACGGGACGAGAGCCACTACGA
CCGCGAGCGACGGGACCGCGAAGAAGAGCGGGAGCGCCAGTATCGTCGGCGCGTGGCTGAACGCAACCCGGACGAGCTCA
ACTACGGCGACGAGAAGCCGCCGTCGGTGCGTCGTCGCCGCGAGGAAGACGACGCCGACAGGCGCGACTCGCGCGATTCA
AAGGTGGGAACGTCTTTTCTTTCTTGTCCTATTCCACTCCTTATCGGTCATTATCCATGCTGACTAATCACAGAGACTGA
GACGCGATTCTCCTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62