GenePrediction:GLEAN_4481 Details

Name: GLEAN_4481
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:508569..489002 (- strand)
Length: 19568
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:508569..501057 (- strand)
Length: 7513
Type: CDS
Source: GLEAN
Position: GCSC_161:501005..498630 (- strand)
Length: 2376
Type: CDS
Source: GLEAN
Position: GCSC_161:498540..492815 (- strand)
Length: 5726
Type: CDS
Source: GLEAN
Position: GCSC_161:492683..491176 (- strand)
Length: 1508
Type: CDS
Source: GLEAN
Position: GCSC_161:490562..489505 (- strand)
Length: 1058
Type: CDS
Source: GLEAN
Position: GCSC_161:489444..489002 (- strand)
Length: 443
>GLEAN_4481 class=GenePrediction position=GCSC_161:508569..489002 (- strand)
ATGATGACGCGTGACGCGCATCGCCGGAGCCCCGACGGCAACGTCCGCCGGAGCCGGCGCAAAGACCGGCGGCGATCGGA
CGAGGCCCTCAAGGCAGCGGCGGCACCATCCTCGACGCGACGGCGACAGGACGGCTATGACCGACCGTATGACCAGCCGT
ATGGCCAGCCAGAATACGGACAGAGAGACTACGGACAGAATCACGAACAGCCGGAATTTAAGCGGCCGGAAAACGAGACA
CACAGCCAGACGGCCGATTACGAGACGCGTGACCGACGCGACAGCTACTGGCAGCAGCCACAATACCCAGACACAGAGCA
GCAACAGCAGCAACAGCACACCCTTCCGAGGACGCGACGACGGTCGTCTCCACAGGCCACATCGTCGCCGCGATCGCCAC
CCCGCCGACGGCCAGCCTCGCCCAAATCGGCTGCTGCCGGCCTTGGCTTTGGCTTCGGTGACCGCGACAGGACAATGCCT
CCACCACAGCGTGGCGGCAGTGCCGAATTCTACTATGCTGCTGCGCGTGCTGGCAGTGGCAGCGGCACCATTCCCATTGC
TAGACACAATGGCCACAATGGCCACAATGGCCACAACGCTCACGCTTTACACTCGCAGACAGCCACGACAACTCGCGGTC
TCCGGGCTGACTCGACCTCGTCGCTCTCGTCTTCTGACTCGTCGACATCCTCGTCGCTGCTCAACATCTCGGCCCCTCGC
ACAACCGTCCAGGGCATCATGTCGTTTTTCAAAAAGGGCAGTCCTGCCCGCACGCGCAGCCACAGTCGTTCGCGCCGAGA
GCATCGCGCCCAGAAGAACAAGCGGCGCCGTTTCCTTCGCTTCGGCAACAGCAGCTCGTCCTCCCTCGATGATGGCCTCT
TTTACGGCAAGGGCTACATTCCCCGGCCACGCGGCCCGCCAGAGGACGACCAGAACGGAGGACCGGCTGGTCAGCCCAAT
GCAAGCCTGGAAGACCTCGAGGGCCTCGCCTACGGCAGCGGTCCATCGCTGCCTGCAGCCACAGCCTCAGCTTCTGCAGC
AGCCGCCGCCACGTCTGGGCCCAGTCGTAAGCCCACCGACGACGAGGAGATCATCCGCATCGGCCGCGAGCTGGCCATGC
TGGCTCGTGAAGACAACCGCCACGATCTCGCTCGCCACGGCCGCCGGCCACCCAGTCGCCTGGTCACGGCCACTGCAGCT
GTTGCTGCTGGTGCCGGTGCGGTCGACAGGCTTCGCCAGTCCCGACGGCGCAACCGGCCTCAGTCGACTCTGGATCTGTC
GGACCAGGAGGCCGACGAGCTGGCTGCCGAGATGGAGCGCCAGGGCCGCCGTCGCGGTGGTGGTGCCTCCCGGCCGCATC
GCCTGTCAGCTATGCAACCTCACACCCATTCGCCCGACGAATCTGAGTGGGAGTCGGCATCGGACGACGACTCGGATGAC
TCTGGTGACGACTCTTCGCTCACTGACAGCGTCTTTGGTGTTGTTTCCACTTATGGCCACCACGTTGAGGATGACCACCA
TCAGGCTGACGACTCCTCGTCTGATGCCGACTCTGGACTGGCGTATGGATCCGGTGTGAGTCTGCCGGGAACCTCCGCCG
GACCGCCTGCTGCGACGACGACGAGCACTGCTGCCACCGCTGGCGCTGCTGCCACCCTGGCAACCACATCCTACTATGCT
GGCACCAAATCGTCCATTGTCGATCCGCGGCTGTTTGGGCCCGTGAACTCGCTGCGTGGTCACGTGACACGTCCTTGTGG
CTTTGGCGACAGCGACGTGGAGACACGCAGACGACGCTATTCCGAGCAGAGCGTGCGCGTCTCGCAGCAGTTGCAGACGT
CGCCGCCGAGCCAAACCGGCTCCCAGACTCGCGACCACGAACGGGACCGTCGCCGCATAGGCACGCCACTGACCATGACT
GCCGGTGCAGCTGTGGTGGCGGCCGTGACTGCTGCAGTCGTGGAAACGCCGGTTCGTCGGAGTCGCGTTGACTCGGCTGA
GCTGCAGTCACCCAAGCCGGTGGTGCCCGTGAGCAAGCGTGTCTTTGACGAGGACGTCGTCAAGCGAGAGAGTGAGCGGC
GTAGAGTTGTCGAAGTTGAACGCGAGACTGAGCGGCGTAGAGTTGTCGAGGTTGAACGTGAGACCGAGCGACGGAGAGTC
GTCGAGATTGAACGGCAGAAGCAGGTCGACATCGAACGGGAGACGGAGCGCCGGAGACTTGTGGAAGTCGAACGACAGAA
GCAGGCCGAGGTCGAACGCGAGACCGAACGCCGGAGACTTGTGGAAATCGAACGACAGAAGCAGGCCGATCTGGAACGTG
AGACGGAGCGTCGGAGGCTTGTGGAAGCCGAACGGCAAAAGCAGGTCGATCTTGAACGCGAGACTGAGCGTCGGAGGCTT
ATCCAAGCTGAACGGCAGAAGCAGCTTGATCTCGAACGTGAGACGGAGCGCCAGAGACAAGCCGACCTCGAGAAGGAGCG
CCAGCGCCAGAAGGAGCGCGATCTCGAGCGAGAGCGCCAGCGCGTGCGTGAAACTGAACGTCAGAGAGAACGTGATCTCG
AGCGGGAGCGGGAGCGTGTGCGTGAGGTTGAACGCCAGAGAGAACGTGATCTCGAGCGCGAACGTGAACGTGAACGTGAA
CGCGAACGCGAACGTGAACGCGAACGAGAACGGGAACGGGAACGTGAACGGGAACGTGAACAGGAACGCGTGCGCGAGAG
CAATCGCCTGAGAGAGGCCGAGCTGGAGCGAGAGAGACAGGCCGAGCTCGAACGTCGACGAGACCTGGAACGCCAACGAG
ACCTGGAGCTTCAGCGGGAGAGCGAGCGCCAGAAGCAGCTGGAGCTGGAACGTGAAGCCGAGCGCGAAGCTGAGCGCAAG
AAGCAGGCTGAGCTTCAACGCCAGCGCCATAGCCACGACGATGGCGACGATGACGATGACGATGACGACAGCGAGCACAG
ACGCAAGATGGAGCGCGAGCTTGAGCTGCGACGACAGGTGGTGCGCGAGTACGTGAGGAGCGAGTCTGAACGGCTGCGCG
AGCTGCAGCGCGAGTTTGAGGAGCGCGACGAGGCGCGCCATCGTGAGCTGCAGGCCCAGAGCAAAAGCCCCGACTCGGAC
GACAGCGACAGCCGCGGCCACGAGCTAGACAGCGAGGTCGAGCACCGTCGACAGGTCGTGCGCGAGTTTGAACTGCGCGA
AGCCAAGCGGCAGCGCGACCGCGAGCAGCTGCCGGAAGAGCCAAAGATCGAGGCTGTGTCCGTTGATCCGCTCCAGTTCC
AGTTCCATGCGACAGACGCGACCTTGCAGACGGCCCAATACGACTCGTCGAAGCAGTCGTCCACACCCAACATTGTCACG
GTCGACGGGCCGTCGTGGGCAGACGACGACGATGCGAGCGCCTATGTGCCGTCGGCACTTCCGTCGCGAGCAGCATCTCC
GGAGAAGTTGGAGAAGACGGAGACGACGGAAAAGACGGAAAAGACGGAAACGAAGATGGAGACAACAGAATGGCGAGGCC
GTGGATTGGCACGCTCCGAGTTGGACGACGGCGAGACTGTGCTGGAGCGGACGCAACGATCGACTGCGCCCATCGACCGG
GCCGCCATCGCCGTGGCCGAGTCCATGGTGTTCAGTGAGGAGCGCGAGAAACAGCGCGAGCCGCCGCGTGGCCGCAAGGA
CAGCCGCGACGCCTCGCGCGACAAAGACGGCCGGACCGAACGCGAGATCCGCGAAGAGGCCGATCTCTACTACCGCACCA
CGACGTTGGCCCGCCGGTTGGCCGAGGAGGAGATCCGCTCCCGCAGCACCTCGCCCGAAGATTCTGTCGTCGACAAATAT
GAGGGCCGTGAGAGAGGGTCTGGGAGTCGCAGGCGAGCTGAGAACAGACCTGTCATCGACGACTCGGAAGACGATGTGCC
GTCCACGCCCAAGAGACCCCCCGAGGTTATCCGCATCGTCACGCCGCCCGAGATGGTCCGGCGACAGGAGAAGAGCCCGT
ATGATGCCCCAGATGCAGACGTGCGCATCGACAACCACATCTTCCCGCGTGACCTCAGCCGCTTCCTCCTTCGGTCCACC
ACCAATCCTCAGGCTTCCATCGTCGCCGAGGATCCCTGGACCTGGGATCGCAGCCGTCGTCGGTCCGTGACGCTGCCAAT
GTTCAAGTCGCGTGACCCGTCCTGCGAGCGAGACCGACCCGTGCTCAATATTGTCATGCCCACGCCCGAGCCATCGCCCA
GCCTGGAGAGGCAGCTGGCTCGTGCAGCCGCGCCGGCGACACCGGTCAGAGAGGTCGAGACAACGGTGCCAAAGGTCCAG
GAAGCCCAGCCCGAACCTGAGCCTGTTGTCGTCGCCATTGGTCCCCGCGGCGAGATCGTCCGGGAAGTCTCTGCTGTCGT
TGAAGAAGACACACCAGCGGCACCAAAGTCGACCGCCGCCAAGAAAAAGAAGCCGCCCGTCAAGCCGGTAAAGAAGTCCG
GTTGGGCCGCCATCCTCGGCGCTGCCGCTGCCACTGGGGCTGCCGCTGCGGCCACTGTTGCGACTGCCGTTGGTGGTACC
AAGGAAGTCGAGGAAAAGGACGAGACCGAGGTCCAGCCCGAGGTCCAGCCCGAGATCCAGCCTGAGTCCCTGCCACAAGC
TCCCCTCTCTCGCCGCATCGAGAGCCCCATCGCCCACGATGTCTCGCCCGAGACGGAGCGCGAACCACGGTGCCCCGTCG
ACATCGGGGCCTTTCCCGACGACAACGACGGCGAGATGGCTCCAATGCCGCCTTCACCGGCCAGCAAGCCGATGACGATG
CCTCGGAAGAGCCAGCGTGTTGTGACCGCCACCACAGCCACGCAGGATTCCGAGCCCGCCGTTGATCTGGAATTTGCAGC
CCTGATGGGCGCCAGCCTGGAGTCGTCCGGCTTTCACAGCGACATTGTGACCGACCCCAAGTACTGGCCACAGAAGCCGG
CCTCGCCGCCCAGCAACAGCCCCGCGACGAGGCTTCAAGACTCGTCGGATGACTCTCAGGATATCGTGTCCGAGACGGCC
CTGGGAGACGGCCCGACAGTGACGGTGCGGTCTGGTCGCAGCAAGAAGCTGCGGCAACGCCGGGAAGAAGCGAAGGAGAG
GCTGGAGACGGCCGTCGTGCCACCAGCTGGCGACTCGCAGCCGGCCTTGTCCAAGGCGCAGAAGAAGGACAAGAAGCGGC
GAGAGGCAGCTGCTGCAGTGGCCAAGCCTGGCGTCGACGATGGCAATGGCCGAGATCGAGATCGAGATCGAGAAAGGAGG
GCGGACGGCAAGGCCGATGAGGAGCCGTCTTTTTTAGCTAATGCCGGCACCCTTGGCGCGGGTGTCGGCTCTGCGGGCAT
GACTGTGGCCGCTGCAGCAACAGCAGCTGCCGTCGCCGTGTATGCTCGCGCGAAAGCCGCCGCCGCTCCTTCGGAGAAAA
AGGAGCTAGAGAGAGGGGCCGTTCCTGAGTTGGAGCCCGTCGAGGAGGAGAGAAAGGTTGAAGTCGAAGCCCAGCAGTCT
GTCGGTGGATCGAGATCTGTTGAGGCAGTGTATGCAGTCGAGGTCGAAGCATTCGAGTTGGACGCTTCGGAATCTGCCAA
CCCCTCCACCCACAATCGTGCGCCTTCAGACACCGTCGTCGACCCTGAGATCATCGAGCGCGTCATCCGCCCGGCCATCG
ACCCCTACCACGGAGACCTGCTGCCACTGCCACCCAGCCAACCTGGATCGCCGCCGATTGAGCTACCGAATTTGGGTGGC
GGCAGCGGGAAGAAGAGCAAGAAGAAGAACGAGAACACAAAGTCAGAACAGGCCGGAAATGACGAGGATGAAGGCCAAAA
GGACAGGGGAAGCAATGACGACGACGTCGATGACGACGACAACGACCAAGGCTTCCGCTTTCCCAGCCTGCCGCCCAGCC
GTCCAGAGACGCCACCTGATCGCGACCATCCCGAGCAGCACCGCGAACGCGAGCTCGAGCAGTTCATCCGCGAGACCATG
GCTGCTTCAGCTGCCGCCGCTTCTCGACGTCGCTCCAGCTCGCTGGTCCGTCCGTCGACCGCTGCCTCCAGCCCGACGGC
CGTGCCCATCAAATACGTCTTGCCGCCGCGTGCTGCCTCGCCCTCGTCGCCCATCGGCTCACCGTCCTCGTCCGCTGCTG
TCAGTATCGGCAGCGTCCCCGAGCTGTCGTCCATCTCGCACAAGCGCATGTCGTGGGACAGCAGCCGCGACCTCAAGCCA
TTGCGCCTGGTTCAGCAGATCAGTCCCTCTGGCCAGCTGCCCGAGTCCGACGTCGTCGCTTCAGCTTTCGGCATCGCCAC
CAGCCCCAACAGCGGCTACAACAGCCCCCCGGTTGTGTCCCCTTCGACCGTCCCCGCCGGCTCCAGCGTTCCTGGTGCTG
CTGCTTCCTTCCGCCGCAGTCTTGGGGGACTCGCCAGCTTTGGTGCTCCCATTGGCGCTCCGGCCGGTGCCGACATGTCA
CCGCTGCGTGAGGCCCTCGCCCGTGCCGCCATGACCGGCAGAGCAGCTCACCGCCGTAGCCTGCCGAGCCCCAATGCCCT
GACGCAGCAGCTGAATGCCTATGCAGCCGCTCAGGCCGCTTCGGCTGCAGCTCGAGCCGCCACCGGAGCAACGCCAGAGG
CCGATGCGGACGAACCGCCGTTGACGAGGCCGCGCACGAGCCCGGCCTATTCGTCTGATTCCCTTCATCGCGACATCAGC
ACTGACGGCGTCCTTGCCCGTCACAAGGCTGCCTCCGCACCGCAGACCGCTCGACATTCGCTGGATGACTTCCGTCGCAG
CGACGTCTTCGCCTTGAGCGAAACTGTTGTTGAGGAGACTGAGCCTGAGCCCAAGCGCCCGATGTCCGCTCCTGCACCAC
AGCTCGCAGAAGATGGCCATCAGATCGACAGAAAATCTGCCGACGATGTTGTTTCTGCAAGTCCTGCCTCTGGCGGTATC
GCTCAGAGCATTGCTGCCGCCTTTGCTCCCACTCTTAACCGCCTTTGGGGAGCTGGTCGTGAGGATGAGAAGCTCGAGAC
TGCGGCCTCAGAGTCTGCAGAGGCTGCTGCGGAAGAAGAAACAGATTCGGTCGAGAAAGAGGCGCCTGTTCTCGAACAGA
CTCACGATTTGCCCATTCCCAGCGTCGAAATTGTCGAGCCAGAGCTGGCCAAGGAGGCCATACTCCCGGCAGAGCTCGCT
GCCGAGGACGTTGACAAGGGCATGCCGGTTGAGCGACTGGCACCGGAGGATGTGCCTCTCCCAGTCGACGAGTTGCCTAT
CGAAGAGCCAGACACCGAGCAACCGATTGCAGAGGCGACCATTGACAAGGGAAAATCTGTCGAGCGCCTTGCACCGGAGG
GTGTATCTGTACGAACCGATGAGTCGGCTGAGGACCAGCCAGTGACGACAGAAGACAACGGAAGGTCTGTTGAGCAACTC
GTTTCCGAATATGTCCCTCTACCAGCTGCCGAGGAGCAAGTCTTGTCCGCCACGCCTACAAAAAAGAAGAAAGGTAAGAA
AGGTAAGAAAGGCAGGAGGGGCTCTCTCCATTTGACCGAGCCAGAAACTTCCTCCCAGGCTGGCGGCACAGCTCCTGCAA
TCATTAAATCCGGAATGTTCGCCGAGACGGAGCCGACTGAGAAGTCCACAGTCTTGCTGAAGCGACAGGAACCTTCCGCC
ATCAAAGACGTCCGGTCTGACTCAAACTTCGATGATGAGTCTGGGCCTGCTGTGGAGACGATAGTCGCCTCCGAAGACCA
CGTTTCCGCCATTCAGACACCAGAGACAGAGAGCGGCTTCCCGAATAAGAACCAGAGTGTCTCAGAATCTCAGACGCCTT
CGGGCCTGGCGAAGGACAGCAACAATCGGGCCGTGACGGTCGGAGAGATGCCGGAAGCGTCAGCGGAGAAAGAGACCCCT
GCCGTCATCCCTGTGGCGGACTCGGGTGACTCGAGCGAGCCTACGGTCGCTGTGGCCGTTTTGCCGATCGCAGAGGATCA
CCAGACCGGGGACGAAGTCGTTGGTCCCGCAGGCGACAAAACCCTGTCGGCAGCCCTGGAAAAGCGGTCCTCCAGGCCTC
TCCTGCCCACACTTGGCCTCTTTGGGAGCGGCAAGAAGAGTGGGCCTGGCAGCAGTGCTGCAGCCACGGCGGAGCCCAAG
CCCCTGCTCGTCCCCAGTACCGACAAATCAGGCAATGCCAACACGCAGCAGCAACCCACAGCTGGGAGCACGACAGTGGA
CACCGCTTCTGGCGAGTTGGCGCCCATCGACCGGGGCGTGCAGCTGCCAGAAGATTCTGCACCCAATGGAGAGGATTCCC
CCATCTCTTCGGTGGGTGTGGCGGTTGAGGAGTCGGTCGATGCGGCCGAGAAGGCCAAGGCAAGCGAAAGCCAGGACCCG
GATTTCTTCCACGACGTGGCCAACACCGACGTCTCTGGCAGTGCTCCCACTGGCCCGCAGCCACCTGAGCCCGAACAGGT
CGTCCCCCCCGCCGTGGATCTTGTCGAGCTGCCAAGTGCAACCAAAGCGGCAACTGACGAGAAAGGCGACCATACGCACA
CGGCAACTGACCGCGACGTGGAACAAGTTACCCCCGCTGCCAGTGATGCCACCATAGACCCATTGAAGATGGCTATTGAT
GCAATTGGGGAGCGGGACACCGTCGACCATGACTTTCCTGTCGTGAAGCTGAAAGGCAAGAAGGCGAAGAAGCAGCAGAA
GCGACTCGCAGCCGCAGCAGCAGCCGCAGCCACAGCCGTTGTCGCTGCAGCGGAAGCTGCTGCAACTGAAGGAACCGCGG
ACGACGCAGTTACCAATGCCGAATTTGCTACACCAGTCGAAGAGCTCCCAGCGTTGGTCGAAGCAGCAGCGCCGCCGGGT
GAAGGGCTGTCTGCTGGCGGGAGGGCTGCTGTTGTCGAGCCCATCTGGGAAACTGTGGATGAACGTGTCGCAGCTGAGAG
CGAATGGCCCAACCTGACGAAAAATTCGAAGAGGGGAAAGAAAGATAAAAAAGATAAAAAGGGCGACGAAAACCCGACAA
CGGTTCTTGAACACGCTATTGTGGACAACACAGTCGCTGGATCCTCCACTGATGCGACTGTCGAGGTTGCGGAGCCAGCG
GAGCCAGCGGAGTTTGTGGGGCCAGTCGAGGACGTTGCCGAATCTGTGGAGGGTGTGGTGGCGTTCGAGCCCGTCGAGCC
TATCGAAGCTGTCGAGGCTGTCGAGGCTGTCGAGACTGCCAAGGCTGAGGAGGTTGCGGAACCTGTCAAGCAGATCGAGC
CTGTGGATACTGCCGAACCCATCAAGGCAGTCAACGCTGCTGAAGGCATCGAACTCGAGGAGGCTAGTCAACCAAGGGGA
ACTGTCGAACTTGCTGCGCCTGTCGAACGAATCGAGAGCACCGAGATAGCTGACCTCACGGATGTTGTGAAAAGCGAAGA
GGCCACTGAAACCAACCTCGCCGAGCCTGCCGAAGCTGTTGAGCTTGTCAAGACAATCGAGCCTACCAAGACCACAGAGC
TTATCGAGACCACAAAGCCCATCAAAGTCATAGAGTCCGTCGGGTCTGTTGAAACTCTCGAAACTACCGCTGCTGAAACC
GAACTGCCCACAACGCCGACAAAGGGCAAAAGCCTGGAGGCCTCTATCTCCGAAGACGATGCAGAAGACAAGACCACGAC
TGAACTTGTGGATGCTGCAGAGACTGTTGAGGCTGCCGAACCAGTTGGAGCTGTTGTGCCAGTCGAAGCTATCGATGTCG
AGGAGGACAAGGCGGCCGAAACGGTCGAAGAAACAACAAAGACAGAGGCAGCTTCCCAAGACGAGTCAGCTGATCCGGTG
CTGCCTGACGTACCTTCCTCAACCGTCGCGAACGAAAGCGAATGGCCAATGACGTCCAAGAAGAGCAAGAAAAACACAAA
GGACAAAAAGGGCAAGAGCCGTCAAGCATTCGCCGACGAGGACTAGACAACTTGGAAGCTGACATCAACTCCGTGTCTGG
GTCCGAGACTGTCAGGCCTTCAGAGACAGACCGGCAGGAACAGCTTGGGCAAGCGGAGACTGGCGAGAAAGTCGAGCAGG
CCGTGCCTACGGAACCAGCAGTAACCTCTGAGACTGTCCTTCCTGTCGAGTCGGTCGAACCTGCCTCTCCAGCGACGCCA
GCGGAGATCATCGTTCCTTCCCAATCCATCGAGCCTGTGCCGTTATCAGAGCTTGCCGATTCGTCCCAGTCGACGGAACC
CGCTGCTGAACCCTCTTCACCGATATCACTGAAGAAGAGCAAGAAGGGCAGGAAAGGCAAAGGAAAGCAGGTCGACACCA
CGGCATCTGAAGCTGTTGACACGACCGAGCCGACAGAACTCTTCTCCGCCGACCGAGCAGTGACACCGGCCGAAACGACA
GATTCGCCCGAACAAGCCGATCTCAGCAGTGCCGGCAGCCCTGAGACGAAAGATAATCTCAAGGACTCCCATATTTCGTT
CGCCCTTGAGCCGGTATTGCACGGAGCTGCGCCGTCTGAGGATGTGCCCATCGAAGGTAATCCTGTGGGAGCAAGCGAGG
CCATCGAGGCAGTCCCGACCACTGTGGAAGAGGTGAATGCCGTGCGCGAGTTCCCACTGCCGGAAGAGCAGGCGCCCGAG
GAGAAGGATCTGGAGAAAGGCGTGGAAGAGAAGCAGCCGGAGCCAGTGAAGCTTTCGGAAGAAATTGCGCCGGAGACCTC
TCTTCTGGCTGGTGCACTCGATGGTGAAGCGGCTGCTCATTCGGAAGAGCCGACGCAGCCGGATAACGAGCAGCCTGTTG
TGGAAGAAACGCAGGATGACAATATTCAGGTTACGACTGCAAAGGAGGAGAATTTGAAGGAGCCTGCTGCCGTCGAGGAA
ATCATCAAGACCACTGAGACCACCAAAGAGGATGTCCATGTCCTCCCCAGCGACGCTGACCCTGTTTCTGAACTCGCCAG
TACAGAGCCATCTGTCGATCTTGTCAAGCCAACGGAGGTTGCTCTGCCAGAGGAGCCGACTTCCGCGAAGGAGGCATCTC
CTGAAACGGCGACACACGCCGAAACTGTTGACGAAGTGGAAGTTCTCTCTGCTGAAGATGAGGGAGCCACTGGTACCCGC
TCGCCTGTTTTGGAGTCCGAGGCTTCAGATGTGTACCCTGTGCATCTCAAGAAGGCGAAGAAGAGGAAGGGCAAGCAACA
GGAGGGTGTGCAGGACGAGACAGCAAGCCCGGATGCGTCTGCACCGGCCACTGAAGTCAAGGCTCCTGTGTCTGAGATTG
ATGGCTCTGTGCCTGTCATTGTTGAAGAGTCAAAGCTCCCGGGTGACGTGATTGAGAAGGCTACCGAGCAACCAGAGTTT
TCACAATCTGCTAGCCACGTTTTCAGAGACATTGACACGACCCTGAGACCATTAGAGTTAGCTGCTGATGTGGACACGAG
TGGACCGAGCTCAACCACGGAAGTCACAGAGCCCATGCCCGCAACAGATCTTCTCGCTGCCCCAAGCCCCCAGAGCGACA
AGAAGAATGAGGGTAGTCTAGCAGCAGGCGACGTGGCGACACAGGAGGAGTTGGCCTCCAAAACAGCGAAAGCATCACCA
GAAGCCAAGGAAACTGCTGCTGAATCTGCTGCGACACCTATCAGCCAAGACACCTCCCATATCGTCGACGAGACTGTGCC
GGCACTCGAGGCATCTGCGGAAGAAGCTCAGCAAGACCTGGCTGCAGAGCCGCTCAATGTCGAGGAAACAACTGAGTCTA
AGCCTTTGGACAATCCTTCGACAGAGGTTGCCACTGATTCTCGCAAGGGGCCTGAAATCAAGCAGGGGCCTGAGGCAGTA
TTGGAGACTCCTAGGGCTTTACCGACCGAGGAACTGTCTTCTATTTCTGAGCGGCCTACTCCGAAATTGTCAAAGAAAGA
GAGGCGGTCCAGGAGAAAGGCACAGCAGCTGGCAGAGTTCGCTGAGGATGCCGAGCTTGAGGGCACTACCAAAGATGGCC
TGCTAGCGGAGGAAACCCCGACTGCTCTGGCGAGTGGTGCTGATGAAGGCCGGAGAGCTGACCCTCAGGCTAAAGCCGAA
ACGGACAACAAGAACGAAGCACCCAAGTCCGAAAGCACAGAACAGGAAGCTGTGGAGACACAGTCTCGAGATGTGCAATC
TGATGAAAACACAGTGCTTGAGCAGCCGAGAGACGACGATGCTGCCCTTGTAGAAAGCGTGTTGCTGGTGGAACCGACTC
TGGCTGCAGAAGGTGCCAACGAAGAGACTCTTTCGAAAGACCAACCCCAAGAATCTGAGCTTTCAGCACCTGTTGGAGTT
CCTGCCGACAGCAACACGCCTCCGATTACCCGGAAACTCTCAAAAAAAGAGAGGAGGGCTAGAAAAAAGACAGTAGGATC
GTGGACTGAATTGGAAGACAACGATTTCCGACAGGAAGTTGAGGCTGTCATTAAGAAGCCCCTATTGGCCTCAGCCCCGC
CAACTCCAAAGTTGTCAAAGGAGGATAAGAAGGAGGACGAGAATACCGCAAAGAAGCCAGAGACGGTAGCTGACGTTGAA
GCTGAAGCGGCGAAGATGAGCGAGATCCCGTCGAAAGAAACTGAAGCTGGTGCCGACGAATCAAAGGAGCGTCATTCGAC
GGCGGGCGACTCGGAAGAGAAGCTGGCTCTGACTGCGGAGGAGGCACGCGCCGATTCCGTGGTCGAGAGAGCTCTTTTAC
CTGAGGCTACGGCAGAGGTTCAAGACGAAGTTCGACACCGTTCGGGAGAGGGATCTCGAGAAGAGGATGCGGGTGGAGAA
GATTCTCGTGATGAGGAGCCTCGTGGAAAGGAGGCTCACGAGAAAGAGGTCGGCAAAGCGGAACCTCGTGAAAAGCTCCA
GGTGGAAGAGGAGCCCGCTGCTGTCGTTGTTCCGGGCCCGAAGCTGTCCAAGAAAGAGAGGAGGGCAGCAAAGAAGGCAC
AGGAAACGAAGACTGACGCTGACGTTGAAGGTGTGGCGCCGCAAGCGGCTGACGCTGCTTTTGTTGATGGGCCGGCTCCT
GGCCCCGAGCAGATGTCCACCGCCATTGCAGAGGACCTCAAGATGAAACCTACAGTTGAGGCCATTTCAACGCCTGCAAT
GGGCGCCGAACTACCGGCAGAAAGTGGGCCTGCGACAACTGTTTTACCAGTCGAGAGCGTGCCTGCTATGGTCGAGGATC
GTGCTACAGTTAAAGAGTCTGTCAAGGTCGAAGAGCTTACTACAGTCGAGGAGCCTGCCACGGTCGAGGAGCCTGCTACG
ATTGAGGAGTCTACAAAGGTCGAGTCGGCACAGGCCGGTGCCATGGAGGGCCCTCGGGAAGAAAAACAGCCTGTTGTCGT
GCCTACGCGTCAGCTGTCCAAGACAGAAAAGCGGCAGTCGAAGAAAAAAGGTTCTCTGGGCTGGGCCGATCTGGTGCAGG
CCGCCTTCCCACCGGCTTCGACAAGCGAACCGACCAAGGCAGCCGAGCCAGCCGCGCGTTCTGGATTCTCATGGCCCTGG
GGAAAATCAACAGCGCCTGCGCAATCGACGAAGCCCTCCCTCCCGGCCGAAGGAACCGGAGCCAACCCGACGTCAAAGGA
GCAGAAGGATAAGAATCAGGACGGCTCTCTGCAGCCAGAACTGGAGCCCGAGGACGAGGACCGGTCTCTCCAGGGCCCTA
CACAGGTCAGCGATACGCCTGCTACGGCTTCGCCGTCCCCCCCGCAAGGTGAAGATGCACCCCCCGCCCCAGCACGTCCC
GGTGGAGAGGAGGTGACGCCTGCTTCCTCTGGCGCCACCAAACCCCGCGGAAAGGAAATGGAGATCCAAGAAACGAGAGA
AGCAGCCTTTGTCCCGTCTTCCTCTATGGACTTGGAGCAGCCAGCCTCACCAACAGTTCTTGGTACAGCCGGAGCAGGAG
AAGAAGAAGAAGCAGCAGCAGTAGCTTTGCCAGTGGCAGCCACTGCCGCCGCCGGCGCAACGGTGGCTGCCCTGACGTCG
CGTTTAAAGAGCCCAAAACTTACAGAATCTGTTTCCAAGGACGTTGAAGACGGCGAGCCAATTGCCGCCCATCCGGTCCG
AGATCGAGACCTGGACGATGCCGACGAACACCTGCCGAAGCAGGCCGTTACCGAACCCGCGAGCGAGACGAACGAGCTGA
GTCCTCGGCTCAGCCCCCACGAGGAGCAGCCGGTGCTCTCGCCCAATGTCAACATGGGGTTGATGACGCGTCAGGATTCA
GACATCTTTGACCGCGAAGGCTACGTGCCACAGCTGCTTACGGGCTTCGGCCCGGCGATCGAATCTGGCGAGGACGAACT
CTCGGCGGCGGCGGAGACAACAGAAACGGAGGCCAAGGCAGCGGAGGAAGCCCAAGAGAAAAAGGTCAGTCCACCACCGT
TGCAAAGTGACGATACGAAGGTGGCTGTGGAGAAGACGAAAGAGGCGACGAGAGAGGAAGTGGGACAGAGCGATGAGAAG
AGGAGGAAGGAGACGACGGAGGTGGAAGTTGCGGGAGACGAGCAGCTTGTGCGGGTTGCCAGCCCCAGCAGGCTTACAGA
GAAGAGCTCGGACTCGTCTGACGAGAACGGCCGTCTTGGCGGAACACACGTTGAGCCAGTTCTCACTCGGCACGTGATCG
ACTACGACAAAGACGACGAGATCGAGAGTCCGATCCTGGGTCGCCGGGACTCTGACAAGCAGCGACACACGCCGCTGAAG
AAGAAGGAGTTTGTCGCGACTACACCGCGAACGGAGGACCGGCTCAAGCGGCCAGTCCTTCCGTCGCCACAGGCAGCACA
GGAGGAGACTCCAGAGCCGGAAAAGAGGGCACAGAACGGACCGCGGGACTGGGATCGTGATGTGTACCACACACCCAAGC
GCACGCTCGGTGGCTTGGCACCGTCTCCATCGATTTTGCCAGAGGCAGCCATTCTGGCAGCTGCATCACCGAAGATCGTC
CATACGCTGGTGCAAGATTCGAACTCTGGCGACCTCCGCCGGTCGGGGTCGAAAGTCCTGCCTTCCGTCCAGGAGGAGGC
GCACGAGGACGACGGGACACACGACAAGGACCACGGGACCGATCGCGACAGCGGTTTCGCAGAGACGCCGTCGCCGTTGG
CTAAATTCAGCCGCCAGGGCGAGAGGGAGCAGCAGCGCGACAGCGGCGTCCACATGCGCGAATGGCCCGAACATGGGCCA
CCAGCAGGCCGAACATCGCCGGCTGAGTCGATTCAGTCAGCAGGTCAGTTTGCACGGCCCAGCAGCAAAAACAGCATCCG
AACTGCAGGACTGCCATCGGGCATCCCCCGAGCCGTCCGGTCGTCGACTGCCCTCGTGGCTGCTGAGACAGGCACGCGCA
GCGTGTCGGACAACACGATCGTGGTCAATCGCAAAACCCGCGCGTCGCCACAGCCTTTGGACGGATTCTACGGACTGCGG
ACACTGTCCAATTCCAGCCTCACGCGGGTCAACACGGAGCCGGTACAACGAAGTGATTACTCAGCAACCCCGCCCTTGCG
TCGGGCGTCCAAGCAATTTGGCGGTGACCTGCGGTCCCTCAGTCAACGCACGGAGCTTTCTGCCATCGGTGGAGCCAGAA
GTGGGGAATTTGCGCCGCCACCGCACACCGCCTCTTTGCCCTTGGAAAACAGCAGAGAGCTGCGTGGTCAGCCGGACGAG
CAAAACCTGAGCAACAGCACACCTGTCGCCAATGAAGGCAGGGTCCGCGAGAAGGGGTCCATGACTGACGTTTATGTTAG
TATTTAACATCTTTTCCCCCTTTTTACCAATTTTGTTTTATTTTATTTTTCCGCCTCTTCCCCGCTTCGGTTGTTCCCGA
CCCGCATTCCTGGCCACCAACGGCTAATGAGATGATTCGAACACAGGATGGGTTTGGCGAGGGCCGGATTGGTTCACCGC
GCTCACCGACACGGCCGCATAGCATGCGGCGACGACAGAGCATGCAGGTGATGGAACTGGAGAACCGGGTGGAGCAGTTG
ATGATGGAGAACCGGCAGCTGCTGGAGGCGCGGTCGCAGATGGAGGTCTCGGTCGGCTCGGTCGGACAGCGAGTAGCGGG
CAAGCTGGCCGACCGGGACGGACAGATCGAGGTGTTGAAGAAGTCGTTGGACGTGCTGCAGAAGGAGGTCAAGCGGCTGA
AGGAGGTGAACGAGGGTCTCAACTCGGCCATCGACTCGTCGGCACGGCAAAACAGCGATCGGACCCGGAAGCTGGAAATG
GAGCACGCGGCATCGCGACGGGAGCTGCACGTAAAAGACGCAGAAATTGCCCAGCTCAGGTCGCAGCTGCTGGCGGCACA
GGAGCAGATCCGGGTGATGCAGGCGCAGATGTTGATGTCGAAGCCGCCCGACACGGAACTGCTGCAACTCCACGACGTGG
ACTACTTTGACCGGCGGTGCCAGCAGCTGTGCGCTCACGTGCAGCAGTGGGTGCTGCGGTTCAGCAAGTTCTCAGACATG
CGGGCGTGCCGGCTGACGGCCGAGATCAACGACGAGAAGGTGGTGGACCGGCTGGACAATGCGGTGCTGGACGGCTCGGA
CGTGGACGACTACCTGCGTGACCGAGTGCTGCGGCGCGACATCTTCACGGCCATGACGATGTACATGGTGTGGGAGTTTG
TCTTCACGCGCTACCTCTTCGGAATGGACCGGGAGCAGCGGCAGAAGATCAAGTCGCTGGAGAAGACGCTGCTGGACGTG
GGCCCTGCAGCGGCCGTGCGGCAATGGCGAGCAGTGACGCTGACGCTGCTGATGCGGCAGAAGGCGTTCCGCGAGCAGCG
TGACCGCGACACAGAGGCGGTGGTGCAGGCGGTGCTCCAGACGCTGAGCACGATTCTGCCGCCGCCAACACACATGGAGG
AGCAGATTGAGCAGCAGCTGCGGCGGGTTGTGCGCGAGGCCGTGGACCTGTCGGTGGAGATGCGCTGCCAGCGGGCCGAG
TACATGATGTTGCCGCCGCTGCAACCGGAGTACGACGCGGCCGGTGAGCTAGTCGAGACGGTGGCCTTCAACCCGGAGCT
GATGAACGAGCAGTCGCACGGCCCGGACGAGAACCCGGGTCTGGCCGGCGTGCCCGTCCGCATCGTTCTCTTCCCGCTCG
TGGTCAAGAAGGGTGACGACGATGGCAATGGCGATGACGAGATTGTCGTCTGTCCGGCCCAGGTGTTGGTGGAGGGTGTG
CGGCGATCCGGCTCGCGCACCGACAGCCACAGCGGTGACAAAGACAAGCGGCGGCTGACGACGCCCAGCTCGGACGCGGG
CGGCGTCAGCCTGCTGCGGGGCATGAGCCCAAGCATGATGTCGACTCCGGGAGGCGTGGCGGCAAACCGGAGCAACGTCA
GCATGAACGACGTCGTCGCGATGCCTGAGGCACGGTACATTGAAGGGGGGATTTAGGTTGTGTTCTGGACGATTCTTGCT
TTGCGTTTGCGTTTGCGTTTGCGTTTGCGTTTGCATTTTACATGTTGTTATGTTTTACGTCTTTATGTGTTCTCCTGCTT
CCTTTGGTTCTTTCCAGTCTTATCACGATGATGACGATACGTGGCATTCCGCGGCCGTACTTGCCTAATCTTTGCCTGTC
TTATGTTGCTCATTCTTTCTTTACCTCTCCTCTCCTGCGACTGTCAGCTTGTGGTTCTCCGGACGGGAAAACGAAAAAAG
CGTCTCGGAATCACTTTTGCATTTGGGCTGTACGCTAGTTATGCTATTGTGACGACAATGACATGACATTTGTACCGGTC
GGTGGGAGGTACTGCAAGCTCGTATTAAATGTGAGGGGGCGGTGGGCCTGATCAGAGGTCAAAGTGAACGAGCCAAAGTG
AATGAAAGTGAAAGTAACAAGTGAGTGAAATCTCTTGAGTTTGGAGACTTGTCAACGGACACATGTCAAAGGACCGAAGT
TCGACCGCGCTCCTGCTTGAAAACTTTGACCTACCTCATTTTATCTCTAAAACAACGTTTGACAACCGTTGAGAACCTAC
GAAGAAGGGTCCATTTCATCATGGAAGATGGCAAATCTGCCCATGCGGCTCGAAAACTCATTCGTGATGCCCGGAAACTC
GTCCGTGATGCTCGCAGACGCCTTCGCACTGCTCAGAAGCCCGTCCGTGACGCCGAAGGACTCGTGCGTGCTTCGCAAAG
ACTCGTGCGTGCTGCCCGAAAACATGCCAGGCTTGCGATTCCCACGACTCCTGCAACGCCTACGACTCATGTGATGCACG
ACAACATGGCCGTCACTCTCAGCCCATTGGAGCAGCTGCCATCGCTGGTTCGTCGCGACGTGCTCGCAAACCTGCCGCTA
CCCGACATCCGCTCTTTGGCCATGGCATCCCCGATATTCTACGGACAATACGCCGGCGACCGCCAGCACATTTTGCGTGA
GTCGTTGCCGCTAAGTCTCGGCGCTGCCTACATCGATGCCATCGGCCTCTACCGGTCGTCCACTGCGAATTTCCGGCGCA
CATGCTGTGCGGCTACCGTGACACAGCTCATCACATCCTACGGGCAGGAGGCTGGCCTTGGCGACTTTGACGTGGAACTG
TTTGACGATGATGAAGACAACGCAGACGGTGAAGCCAGCATAGATTTTGATGGTGCTGATAACACGGAATCACTTTCCCT
GTCTCCTGCGTCACTTACTCCTGACAACATCAGTGCCATGTCCAAGTTCCACATGACGACAATCCTGCCGCTCGTGGATA
TGTTTGTCAATCACTCGTTCGAAGCGATTTTAGACGTTGGCGGGACCTCGAAATGGTCAACAAATCCAGAGGCTTGTCGC
CTGCCGCTCAGCACCTCGGAAGCTGGCCGCATCGTGCGGGCGCTATACCGCTTCCAAATGCTATTCAACCTCTTCCATGC
AAAGGATAATTGGTTTTTTACTGTGCGCACTGGGCTTATAGAAGAACTATACAACGATCCAGCTATAGCTTACATGTTCA
AGCCTTGGGATCTTCATGAAGTAGTTTCTGTCTTTGAGTTCTTGGATGGGAGCATCGAGAAATTAGTTACTGATAAAAAG
TTCCAGGAAAAAGTCTACCATGTTGGTAAGACATGTCTGCCCTCTGCTTGCTGATAGCTTTGTGTCCTGACAATTTCCTT
TACAGTTATGGACAGGTGTGACAATTTGGCAGAATTGTCGAGACAAGGCCTAACCTTCATACTGGCCTTTTTGACATGGG
AGCACAGCACGGAGAAGTTCATCTCGCTAATCTACCGAGAGGATGACTGGCCTTTGGATTTTCCTAGACGCGTCCCGGAG
GGTGTGGAAGAGGCTTATTTACGAATATGCGAAAGCAACCCGCCCTTCAATGGCGATCATGTGATGCTCCATCCGGACGC
AGACTACCCGTCGTTGGCATGGACTATCGCTTGTAAAGCTCCCAACGGATTCATCAGTAGCATACTGCAAGGCTTCCCAC
TCGAAAACTGCGGCTGTGTCATGTGGGATGCAGACCGTCTGGTGGCTACGGGCCTCAAGAAAATCATGGCTATCAAATTG
CTTGAAGTACTACTAAAAGGGATCAGAACTTCTCGGCCAATCTTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62