GenePrediction:GLEAN_4482 Details

Name: GLEAN_4482
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:486030..484462 (- strand)
Length: 1569
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:486030..485813 (- strand)
Length: 218
Type: CDS
Source: GLEAN
Position: GCSC_161:485720..485666 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_161:485565..485486 (- strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_161:485416..485160 (- strand)
Length: 257
Type: CDS
Source: GLEAN
Position: GCSC_161:485089..484789 (- strand)
Length: 301
Type: CDS
Source: GLEAN
Position: GCSC_161:484735..484462 (- strand)
Length: 274
>GLEAN_4482 class=GenePrediction position=GCSC_161:486030..484462 (- strand)
ATGAGTCTTCCACCTCCGCACGGCTATGCCGACCAGTATGCCCACCACGCGCCACCGCCACAACAGCAGCAGCAGCAGCA
GCAACAGCAACAGGACCAACCCTCGCACTCATCTGCTACCGCTAGCCACGATTCAGCTAAATCCTCCCCGGAGCAGGACG
CAGCCACTCGAAAAGCTTTGGAACCTATCATTGGCAGCGAAGGAAGCCGGTCGTACAGGTATGTCGTCCTGTGACGATTC
CCGGCCACTTGGGCCTGCGTCTCTCGCATTCTCGTGCCCTGCTGACGCTGAACGTGGCGCCTTCCAATAGACTCGACGTG
GTGCAACAGCCGAAACGCGCGCGCATGTGTGGATTCGGTGACAAAGTATGACCTGGCCCTTTACTGCGTTTCATATCTTA
CCTCTTCGCCTACAGCGATGTGTCCCCTTCCCCTCTTACTTCTGCTTATACGGCCCGCTTCCTAGGACCGTCGACCTATC
ACCCCGCCACCATGCGTTCGCATTGTGGTGACAGATCTGGCCACTGGCAAGGAAGTGGATTGCAAGTATGTGCAACCGTA
GACCCCGAACAGAAGGATAGCAGTCGCATGATAGCTGACACGATGCCGCTCCAGCGACATTGAGCACACCATGTTCGTCC
TGAACGTGGACCTCTGGTCGGAAGATGCACTGAAGGAGGTCAACCTCGTGCGCCATACCACTACGACGCCCTCTATCTCG
TCCACCACCCCGGCCTCCTACGAGCAGGTCGAGAATGCTTCGTCATACTCGGCCATATTACCCTCCAATCCCCGGGATCA
GGGCTACGGGTCCGGCATGTATGGCCATCCGGGCGCAAACGCATACGGGTCCCAGCCGCATTATTCTCAGGGTATGTGTT
CGAGGGCCGCCCGTTGGGCTGTTGTACCGGTAGCCCGCCCTCCTAACATGTCGCATTCTAGTCTCTGCCTACATGCAGCA
CAACGGTTACGGCCAACCCAGCCAGTACTACCACGGCGCAGAGTACGGCGGCATGCAGATCTCGTCGCAGCCTCAAGGCT
ACGGACCACCGCGCATCTTTGGCGGCCCCGGAGACATGATGACCCAGCGCCTGATCCAGGGCAACCAGCCGCAAGGCATG
TTCACCCGAAACCTGATTGGCAGCTTGGCTGCGAGCGCCTTCCGCCTGCAGGACCCCAACGATAAGATTGGCATTTGGTT
TGTCCTCCAGGACCTTAGTGTGCGGACCGAGGGCAACTTCCGGTAAGCATTACCCTCTGTCAACAGCAGCAGCTAGCCGA
CTAATCGTCCCATAGCCTGCGATTCTCGTTTGTGAATGTTGGCGCCCCGCCCACAGACCCCAACGGAACCTCATCCGGCC
AGATGTCGATCGTCAACACAGGCAAGGCACCCGTGCTTGCCTCCTGTTTCAGCGATGTGTTCACCGTCTATTCGGCCAAG
AAATTTCCGGGCGTGTGCGAGAGTACCGTTCTCAGCAAGACGTTTGCAACGCAAGGCATCAAGATTCCCATTAGGAAAGA
GGGAGCTGGCAAGAATGGCCGTGGTGAAGAAGATGACGATTACGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62