GenePrediction:GLEAN_4483 Details

Name: GLEAN_4483
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:482664..482169 (- strand)
Length: 496
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:482664..482468 (- strand)
Length: 197
Type: CDS
Source: GLEAN
Position: GCSC_161:482397..482169 (- strand)
Length: 229
>GLEAN_4483 class=GenePrediction position=GCSC_161:482664..482169 (- strand)
ATGGCACAGCTCTCCTCGCACGGTCGCGGTGGCGCTGGCAACATTGTGGACAGCTCCAAGTCGCCCAAGCTGCAGCCCAA
GGATCTGGAAACGCCTATGCTCAAGACGTCCATCGTGACGACCGGCCGCGGAGGCACGGGCAATATGGCCCGCAACACGG
ACCCCAAGGAGACGCGCGCGCGCCAGGACGTGGAGCCGTAAGTGCAGATCCCTGGGAAGCAAGAGAGAAAAGAAGAAAAG
AAGATGACCGCGACTGACCATGTTCAGTGTGACTCGTCGTCCCAGCATTGGAGCTGCACATGTCGGCCGTGGCGGCACCG
GCAACGTCTTCAAGGCCGAGGAGGTGGCGGCAGCAGAAGACGGATCGGCCATTGCTGACGACAAGTCGTCGACGCACTCG
GACGAGAGGAAGAAGCAGCATCAGCACAGCCATAGCCACAGCAACAACGGCCTCGCGGCCAAGGGCAAGGACTGGCTGCT
GGGAAAGCGGGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62