GenePrediction:GLEAN_4484 Details

Name: GLEAN_4484
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:481376..479999 (- strand)
Length: 1378
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:481376..480616 (- strand)
Length: 761
Type: CDS
Source: GLEAN
Position: GCSC_161:480437..480141 (- strand)
Length: 297
Type: CDS
Source: GLEAN
Position: GCSC_161:480053..479999 (- strand)
Length: 55
>GLEAN_4484 class=GenePrediction position=GCSC_161:481376..479999 (- strand)
ATGCGATTCGAAGACGTGCCGGTGCGGCCGACGGCGGGACAGCTGCATCGTCTGGGCAGCCATGTGCCGTTCTCGCTCGG
CCTGCTGCGGCGGCTGCAGTCGGCAGCTGGAGCATTGGACCGGGCAGCCGAAGATGCGATCTCGGGTGGGAGCAGCGCGT
GGGCGCATGTCTTGTTTGTGTATGCAGACGACGACGAGAAGGACGGGGCGTTTGCGGCAGCGTATGTGGACCTCTCCAAG
GCGCCGGAGACGCAAGTCTGGCTGTACGCCTCGGACGAGGATGCGGACGGGGTGAATGACGGCACAGCGGTGCCTCAGGT
CGATCGAGGCGCAGCTCTGGCGGCCAGCTGGTCCGAGGCACGGCGCACACGCATGCGGTCACTCGTAGGGGCTCTCTTGC
GACGTGTGCGCAGCCTCACGGCCGAGCAGGCGCCGTTGGTCGAAGCCGTGGCCGCTCACTGCACGACAAACGTCAAGATC
AACATGCAGGAGGGCCTGCGACATGTTCTGGCGCCCAACGTCACGGCCAAGGGCACAACCACGACGACAGCAGGTGTCAA
TGGCAGCGTCACGGCCGTGTACTGGGATGCCTATGATCGCTGGCTGTTTCGCGTGGCCGACATTCCACCGGCGCCGTCGC
CTGTCGACGGTGATGAGGATCTCGTGGCTGTTCGTGGATTCGACCGACCGCTGCGTTGGGATGTTGTTCGTCAACCGGAT
GTGTCTCTGATACAGTCGCGGACACATATTCCACGGAAAGAGTATGTATTTTTTTTTTCTTTTTCTTTTTTCTCGCTTCG
CTCGATTTGTTGTCCTTCTCTTATTTTTTCTTTTCTTGATTTCTTTCCTCGCTTCGCTCGATTGTCCCCTCAACTTGTTG
TCCTTTTTCTTCTTTCCTCGCTTCGCTCGTTTTATTTTTCTCCCTTACTCACCTCTCAGAGAATCACTTCTCCTCGTTCC
ATCAGTTGCCCTTCGTGACGGCAACACCCTCATCGCCTGGGCCTTTCTCGGCGTCGACGGCAGCATCTGGACGCTACATT
GTGAGGAGCCGTTCCGTGGCCGCGGCATCGCCAAGGTCCTTGCCGCCCGCCTTATTCGGCTTCACAACGGCATCTTCAGC
AAGAACACTGGCGGCATTGACGACGGCTGGTCTCACGCCGACGTCTCGGCCACCAATCCGCAGAGCCAGGCGGTATGTCG
TAGTATTGGCGGCCAACGGGCCTGGTCGTGTGCTTGGTAAGTTTTTTTTTTTTTTTTCCCTTCGCTTCGCTCGATTCATC
TGTTTCTCGTTTTTTCTCCTCGCTTCGCTCGTTAACAACCCAGGATCATCCTCAACTACGATAGCTTTGGCGACGATATT
CCCGGCGAATGGACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62