GenePrediction:GLEAN_4485 Details

Name: GLEAN_4485
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:478519..472197 (- strand)
Length: 6323
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:478519..478327 (- strand)
Length: 193
Type: CDS
Source: GLEAN
Position: GCSC_161:478261..476087 (- strand)
Length: 2175
Type: CDS
Source: GLEAN
Position: GCSC_161:475527..475279 (- strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_161:475205..474493 (- strand)
Length: 713
Type: CDS
Source: GLEAN
Position: GCSC_161:474445..472295 (- strand)
Length: 2151
Type: CDS
Source: GLEAN
Position: GCSC_161:472232..472197 (- strand)
Length: 36
>GLEAN_4485 class=GenePrediction position=GCSC_161:478519..472197 (- strand)
ATGTGGCTTGACCGGCTTGCAATTCGGCCGTTCTGGTTGGTGCTGCTCGGAAGCTCATCAACAGGAAGAGAAGAAGAGAA
GAGGAAAAGTGCAAACCGGATTGGCGACGGTCTGGACGACTCGACGACTGCCGACGACTGCCCGACCATACGCGGCATCG
GCCATCGACAGTCGAGTCCAACAGACGGGCATGGTGCGACGATAAAGCGCCTGTCGCGATTCGTCTTCGGTCCTCCTTTG
GGCTTCTCTTCACAAAAGCCATGGTCTCGCGGCGCTGTTCCCCTGACCTCGCCGTCGCGCCTGTCCGGTTCTGTTACTCG
CGCCGTCTTGCCAGCAACGTACCCGGTCCGCTCGAAAGCCGTCGCCGGCTGGGCAAGCGCCAGATGGCCGACCTGCATCT
GCACCTGCATCTGCACCCGGCCGCGCTGCCGGCTGCCTGGACCAGCGCGGCCACGTCTGCCGCGGCCGATCTGCGCCGTC
AGTGGCAGTGGACGCCGCCGCGGGACGCTGCTGCCCGGCTGGCACGCGAGGCTGACGTCCGTGGCGTGCGCGAGGCCCAG
AACGCATGGGCTGCCGTGGTCGAGGCCATGCCGACCTGGCTGTCCAGGATGATAGAGGGAAAGAGAGGGGGAGAAGGAGA
GAGCGAAAAAACCGAGGTCGACACTCTCAGAGACATCCCTAGAACATCCCACGCCACAGCGCAGACCCTGCTTTCCGAGA
TGGACGCCTCTTTGGACCCTTCCTTTCTCGACGCCTTTCACACCCAATTGCGCCTTGCCGCTCTCGAGCCCGACCACGCT
CTCGCCATCTTCGATCGGCTCTGGCTCCGACAACAAGGTCTGTCTGATGTCGCCGCTCTCTTTGCTGCCGTTCTCGATGG
TGTCCGCAGCTGTCGCCTTCTGCAGCCTCACGACCTCGGTCCCGCCTTCTGGCACCGGTTGCTCCTCTGTGCTGCTGACG
CCGTGACCACAAACACAATGACAGCCACCATGTCTGGCCATCTCGCTGCCGAGATCCTCTTGACTGCACCACCCGAGATC
GTTCGCCAGCTCGACCCCAACACTACCCTGCCGCTTCTGCTGGCTGCCGCCATGACGACCGGGTCCACCGCTGCGATACG
GTGGTCTTCTTCCTCGTTGACCCCCTCTCCCACCGCCAGTGCTGCCTGGACCAGCGCCAAGCTACAGCGCCAGCTCGACG
CTATCGAAGTCGCCTGTTCTGCTGGCGACCTCTCTCGGGCCACTACCGCCCTCCAGACCGCTCGTGGCCTGCACCAGTCT
CTTGTGCGCACACTCTGGCTGGCCGGCCGGCTACTCTCGCCCGACCACGTCTTTGCGGTCGCCATGGCTGCTGTTCTGCA
CGATGTCGACCCCGTCGCTCTCGTTGCCGCCACCAACAGCCGGCTGCAGCAGATGCCGATGCAGAAACACCTCTCCCAAG
CCACCCGCCACCGCTGGCTTCTCCTCTTGGCCCATCTGCCACATGTTCGCCAGGACGGCTTCTTTCCGGCTCTGCACATC
TGGGGTGCCGGCCTCAGCCTCCCGCAGCTTTGTCGCCTCTTGCTCGCCCACTGGCACAGCCGCGGCTACGTCACCGAACA
GGCCGCCCTCTCGTTTGACCGCTTTGCTGTCGATGGCCACAATCTCGACCACATCGCCCTCGCCGCTCTCGCCCTCGCCG
CCTTCCGCTCCAAGCATAGTCGCTCGCGCTGTGTGGCCCTCCTTCTCAGCCTCTGTCGCTCGCTGCAGCTGCTTGGCCGC
GATGCCCCGACCGAACTCGCCCGTTCTGTCGAAGCCTTGGCTGCTTCTGCTTCTTCCACCACCTTCACCACCCTCCCCCC
CTCCTTTCTCGAGGCTGTCGCCTGGGCTGCCGACGACGTCAACGCCCTCCTTCGGCTCTACGCCGTCTATGCTGCCCAGC
CGAATCGCTCGCCCTCTGCCGCCTGGAGCATCGCCTTCTGGGATAAATTTGCCGACCGCATGGCTGCTGGCCTCGACGAC
GGTTCTCTCTCCCTCACCCAGGTCGCCTATCTCCTCGATCTGCCTGGCTCTGGCCACGCCAAGACAAAGACGCAAAAGAC
CCAGACTCAGAAAGGCATCAAGAGTCCCACCATCCGACTTGTCGAGCGGCTCGCTGCTCAATATGCTCTCGATCCCAGCG
TGTCCTCGAGACAGGCTCTTCGCGGCGTCGAGCTCTGTCGCACCTTTCTGCGTCGCCACCGCCGAGGACCTATCCCCGTA
CCCTCGCCCACTACTCTTCGCGCCCTCTTCCACCTCGTCACCCGCGATTTCCACAACGCCCAGCCTGGCCGCACCACCCG
TCTGCGCTGGTACCTCACTGCCGTCGAGCAGGAGCACGGTCCCGACGTCGCTCGTACCAGCGCTCTCGCCCTGGCCCGCT
GGCGTGTCTTGGCCATTCAGGCTGGACACCGTCGTCCTGATCCCAAATCATAGACTCCGTACATCGGAAAAGAATAAGAA
AAAAAAAACATCATGACATCCAAACGTGCATCACGTGACTCCCCAATCCCAACAATCAACAGCCAAGAACACAACCGAGA
CACTGCGTTTGCCTCCATCGCTGTACCATAGTAGCTCTGCGTCACACGACAGACTTCTCCTCGTCCCCATGCTGCAGCCA
CAACAACTCACCGCCTAGAATCACGCTTGCCTGCCCTTCGTCTGATCTTTCGCCTGCCCTCGCACACCAATCGCCTTGTG
TCCTCACCTCGCTGGCGCGTCTGTCACCTCCACCGGATCTCTCTCTTCCACTTGACGGCTCGGGAACGTGCGTGCTCCAG
GCGGTCTCGAGAAGCGAGCGGACGAGACACAGCCTTTCTCGGCGAGGCCGTCCCATCGCCTCCCGTCTCGGTAGAAGTCG
CCATCTAGAACACATGGCAGCTCATCGAAGCCGAGGCCCACAACGAGCCATAGCCGGAAGCGTACAGCCTGCAGCCCGTA
GCATGCATGCAGCTGCTGTACCAACCACCCAGACGACAAGGGCCTGATATCTTGCCAGAACATCTATACGCCAACAGATC
CAGACGTCCTGGTGGCCCGTCGCTCTGGCGAGACCGCTCTGCTTCCTAGCATCCGGCCAAGTGAACGCCAAGAAGGCAAG
AACCAGGTGTCTGGTAGGACGGCTGAAGCTTTTGCCGAGATATGCCGAACTGCACGACCGCTCACGTTCTGTGTATCGCA
GCAGGCTGCTTACCCGTGCGGCAGCACAGACATCCTCTCCCGTCCAGAAGCAGCTATGCGCCCCAGGTCGCCTCACCTTC
TCATCTCTCCCGTTGCCATTGCATCCTTTCCAAGCTCTCTGCAAGCTTCACACAATCGAATGGGACATGGATTGGCACAT
GCATCAGCAGAGCAACATCCCGACCGAGGAGCTCCCGCTCGTGAAGACAGAGGCTAGTATCCATATGGCCAGCTTCGCCG
ACCATTGCGGAACCTTTGGCCTTGCCCACGCATATCTCGGCGACAGCGGCAGCTCACAGGCCGTGCCAGCAACACCAGGC
GACGAACCGGCCATGGCGGCGACAAAGAGGCGCATGCGGTCCATCAAGTCGTGCCTCGAATGCCGTCGACGCAAGCTCAA
GTGCACCAAGTCGCAGCCATGCCGGAACTGCGCCAAGGCTGACCGGCTGTGCCTTTATCTCGGCCACGATCTGGACGCCC
TCAGCAAGATGCAGATCAATGGAATCAAGGAAAAGGTCGCCTGGCTCGAGCGGGAGCTCGAAAAGACGGCGCGGAGTCGT
CAGCGCCTGCGCACAGATGTGACCATGCCGTTCCGAGTCCCGCAACAAGCACAGCCAGCCGTGGACGTGTCCGGCATGTC
CACGCTCTTGCCGCAGCTCCAACCGTCGCCTCTGGTCGCAGACGATGACGACGATGAGAACGAGGACGACAACGGAGGAG
ACTCGTATGGCTACAGCCAGGACATGGTCGACCTGGGCATTCGCGTCGGCAGAATGCGCATCACCGAGTGGATCGGAGGT
CTGAACCGGCCGCGTCTGGCCGAGGAGGTGAGCAAAAGGAGGCACAAGGAGGCTTGCCCAGGCTGACACGACAGATCGAA
ATGAGGCTCTCCGGCACCGGGACCTCTGCAGTCAAAGATGTCGATTCCAACAGGAAGAGAAAAGGCGGCTGTATTGGTGA
GATCCCCGACTTTCTGCTGCCGTCCGACGACTACATCATGCCGGCCAGTAACCTCTGCTGCGGCCCCTTTGCTGCCAATC
CGCCGGTACAGCAGCTGCTGCCGCCGCCGGCCGTCTGCCGTCTTCTCAGCCGCAGATACCGCGTGTCCGTGCATCCGGTG
GCGCCCTGTCTGCACTGGCCATCGTTTGTGCCGCAGCTGTCGTCGTTCCTGTCCGAGGTCGCCGGCCAGCCGATTCGACC
GTCCCGATCGCCCCGACCGTCGCTGCAGGCGCTCGCCTTTGCCGTGCTCTTTTCTGCTGCCGTGGCAACAGACGAGGCCG
AGGCCGCCGAAATGGCCGCTGCCTGGTCGCTGTCGTCGGCCAGTCCGGCCGCCAGCCGCGTGCAGCTCGTCCGGGCTGTG
CAGTGTGGCCTCGAGGCGTCACTCACAGCCGCCGACTTTCTGCACACCACATGCATCGAGACGCTTCAGGCGTTTGTGCT
GTATCTCATCACCCTGTGCCGCGCCGAGATCTCGCGTGCTCACTCTGTTCTTGTCAGTGCCGCCATCCGCATGGCCGAGT
GCATGGGTCTTCATCGCGACGGCCAGGCCTTGTGTCTCACGCCGCTCGAGGTTCACATCCGTCGCCTGCTCTGGCACCAG
CTCTGCTTCCTCGACATCCGCACCTGTGAGGCTCAGGGCCCTCGACCTACCATCCGCGCAGACGACTATGACACCCGCCT
GCCTCTCAATTGCCGCGAGGAGGACCTGCAGATTGCCAGCTCGCGCTCTCCGTCGCCCTCTTCCGCCTGGACACCTATGT
TGCTAGCCGTCATTCGCTTCGATATTAACGAGATGATGCGCGTCGTCTGGAACGACCGCCGTCGCCTCGAGGCCCATCGC
ATCTCGCTGGCCGACGTCATGACCAAGATCGAGCACTTTCGCCGCCACATCTTTGCAAAGTACGAGCCGCTGCTCGAGCC
CAGCGACTGCGACAGCAACAATACCGCCGCTTCCCGTCGTTATACCCGCCTCGTCATGCAACTGCTCGTCTTTCGCCTGC
ACGTCATGGTCCTGCATCCCTACCACGCCAACACGACGACACCACTGCCCGACGACCTGACGTCCATCCTGCTCAAGAGC
GGCGTCATGATCGTCGAGACTGCCGCCCAGATCGAGACTAATCCGTCTTTTGCTCCCTGGCGCTGGTATGGCGGCACCTA
CCAGCAGTACCAGGTCGCTTTGCTGCTGGCTACCGAGGTCTTCTTCCGTCCCGACTCGCCCTTCCACCAGCGCATCTGGC
GCTGCCTGCATTTTGTCTTCGATGTCGATCCGTCTCGTCCGAGCCAGGAGAAGAGCAAGGCCATCCTGCGCGAGATCATG
CACAAGACTGCCGTGTACACCCAGCAGCGATGCATGCGGGCGCTCACCAACATTGCCCAGGCCGTACCAGACCGTCAGAC
AGTGCGGCACGCAAGCACACCAGCAGGATCCGGATATGTCGACAGCACCGAGAATTCGCCTGCAACTGCCGTTCTCATTA
GTGACATTGACTCAAATCACAACCCATTCGCTGCGCCTTTGGCGTCTCTTCATCCTGTCCATGGCCACCAGCGAGAACAA
CAAAGCCAGTATCGGCAGCAGCAACAGCAACAACACCACCAGGAACTACCATGGCACGTCTCACAACAAGTTATGGAGCA
ACACAATCACAACCCACATCCAATGGCTGTCGATATGGACGACTTCGCCAGCGATCCATCATTACACATGGCACCACCGC
CGCTGTCTTCCATGCCGCCACCATCTCTTCAGATACCTCTACGGCCAAACTTGCGACCAAACTTGCAGTCAAACCTGCAG
CCACACCCGCAACCTCTGCAGGCCCCTCCACAACCCCTCTTCTCGCAGAACATGGCCTTTGCCGGCGTCACCAACGGCGA
GGCGCTCTGGAGCCTTCCACAGAGCCAGCAATCCGGCATGGATAGCCCCGAGGGCTTTCCCGGCTGCAGCGTGGATGCGG
CCTTGTTTATCCCGCCGGTGTATCCTGCACACCTGCCGCTGCAGAGCTTGGAAGGGCTGATCTGGGTGAGTGGCGGTGTC
TCGGGGCAGTCTAATTTCTGTCGCTTCCCACTAATACTCTGCTTTAGGATGAGTTCGAAAACACGTTCACGACACAGCTG
TAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62