GenePrediction:GLEAN_4486 Details

Name: GLEAN_4486
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:461768..457547 (- strand)
Length: 4222
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:461768..461247 (- strand)
Length: 522
Type: CDS
Source: GLEAN
Position: GCSC_161:460726..460555 (- strand)
Length: 172
Type: CDS
Source: GLEAN
Position: GCSC_161:460501..460140 (- strand)
Length: 362
Type: CDS
Source: GLEAN
Position: GCSC_161:460085..459672 (- strand)
Length: 414
Type: CDS
Source: GLEAN
Position: GCSC_161:459618..459160 (- strand)
Length: 459
Type: CDS
Source: GLEAN
Position: GCSC_161:459103..458200 (- strand)
Length: 904
Type: CDS
Source: GLEAN
Position: GCSC_161:458124..458080 (- strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_161:458028..457758 (- strand)
Length: 271
Type: CDS
Source: GLEAN
Position: GCSC_161:457700..457547 (- strand)
Length: 154
>GLEAN_4486 class=GenePrediction position=GCSC_161:461768..457547 (- strand)
ATGGTTGACCAAGCCGACATGTCGGCCCTGATACGTCGCAAGAGGAAGAGGGCTGACGCAGACGACAGCCGCAACATTGG
CGAAGCTCCACCCTCTCGTACGAAGCAGCCGAGGAGGGAGGCGTCTTCGGAACAGCATCCGGCAGCACACCGTCAACTAG
ACCCTGTTGTAAAGCATGCACTACTGACACGGTGCTTCCCACAAGTGCTGACACTCCGCGCCTACCTCTTGAGCAGGCTG
CCGGCCTCGTCCCGGATTCGCCGAAAGAAGCTCCGAGAGGTCGGCCTCGCTGCAGACCCCAGCCCTGTTGAGCAGCGCCT
ACGCCGCCTGCTAGACAACGCGCTTGTCGCATGCTCTCACCATGACGGTTCCGGCCAAGGAGACAAGCCGCTCGACTCAC
TTCCTTCTCTGCAAGACGACCGGCAACAACAGCGGCTCGCCTACATCGAGCACAAGAGAGCAGAGGAGTCGCACGTCATC
ATCTCAAATGCGCAGGAGGGTGTCTTTTCTCCACAGTCCGAGGTAAGACATTGTGTGTCTCGCGCCGCCTGACATCAGCA
TTGCTCACCAGACAGATTGTTGATTTTACCGTTTGGTTGCTTTTCAAAAGAGCAAAGCAGAACGCCAGGATCCCTCAAAA
GACAGGCGCGGGAGGAAAATGGTTCAGCGACCTTCCCCAAAATGTGCTGTGTCATGGCTTCCAGAGAGGTCGAGGACCAT
CACCCGTGGACATATCGATCGCGGAAGGGGACGAAGAGGGAGAAGCAATCTCTCCGTATCCGTATCCTTGCAATAGCACC
ATTCCAGATCTTCACTGCATAAGATCGCCGCAACATGCCCAGGCACTGAAGGAGAATCCGTGGCCGCAGCTCCTAGCTTT
GTTAGGAGCGGCAGGCGAGAAAATCATGCTTGATATGTTAATTGACTGCTCGATTTTTCTCCCTGTCGATGCTGGACGCA
GCAATCTCATCCAAGCTTCCGGTGCGTTGGCATGTCTGAGTCCGAGGAAAGTAGAAGACTGACTGACTTCCTCTCAGGCA
AGCCCTTATGCAACTTGGAGCCCTTGACCAAATTTCAAGCGACAGAACAGACAGCACGCGATACACGTGATGAAAAGAGC
CTGTCCGACATATCCTTTGTGAGAAACCGCATGTTCTACGCCAAGCCGAGCATGGCGCAGTCTGGGGCGGTACACTTTGG
ATTGAAGCATATTCGTGAGGTCATCCCGGTATCATGCGACATACGGGGCCAATCCTAACACGTGCAGATGTTCTGAACCG
TTTCTCTTACCGAAGCTGTCCAACCAAGAAGGTCGGCTTGCAGGAATTGGCTGCAGCCAACAATCATGGCACCGTCCACA
TGATGATGTACATGTTTCCTCGACAATTTGGCCTCCACAACGTCTTCACGTCTGTTGTGGATCGTGCCACGACGGCCCAG
CGATTCCAGGATTACACACTGCGAGAGGCCGAGATTTCGGCCAAGTTTGGCAAAATCGGCTGGAAAGATCGATCCGCTTC
GGTTCGCATTCCCAAAAGGCTAAGAGGGATGGCCGTTCATCTCGTCGAGAGACTTCGGAAACTCCACAATCGATGCTCTT
ACTACGAGCTTCTGCAACACTACTGCCCTGTAAGCCTCCCTGTGGTGCTTGTATTATTCAACGTCTAACTACAGCTCTCG
TAGGACATTGCATATCAAGAGACAAGGCACGAAGTTACCTCTGCGGAGCCTGGTAGTCATAAGGAAGAGGCCCACACTTT
GGTCAGTTTAGGACATCCGAATCAGGAGTCCGCATCGAAGGATGTTGCAACAACTGGTCAAGACCCTGCGCCACAACGGC
AGCAGTGCGTCCCATATAGTTCCAAATCCGGACCGGAGCTGAAAAGCACGACGCCTCTGGTGGAACTTGCCACACCGCTG
CAACGTGTTTCCACCTTCTGTCAGGCTGTCATTTTAAACGTTGTTCCCAACGACTTCTGGGGCAACGGTGAGGCACAGGC
GAAAAACAGGCAAGCCGTTCTCAAGAAGGTCGATCTGTTCTTGCGGCTGCGGCGGTTCGAGACGCTCAACCTGCACGATC
TTATGCAGGGAATCAAGGTAGGACTGCCCCCACCGCAATTCCAGACAGTGCTTGCTGACCCTACCTTCAGATCTCGGACA
TTCTGTGGCTAGCTCCTCCCGGACTTCGAAAGGGCAAGATCAGCCAGACCGATGTTCAAAAAAGACGACAGATTTTTGCT
GAGTTTCTCTATTATCTGTTCGACTCGTTTTTGATACCCCTTGTCCGCAGCAACTTTTACGTCACCGAATCCAGCAGTCA
CAGAAACAAGCTCTTTTTCTTCCGCCATGATGTCTGGCGTCGCATCACAGAACCAGCCCTGGTGGGTCTGAAGGCCAGAA
TGTTTGAGGATATCAAACATGGCGAGGCTCTCCAAATCTTGGGATCCAGGGACCTGGGATATGGTCAAATCCGCTTGCTT
CCGAAACAGGCAACCGTGCGTCCGATTATGAATCTGCGTCGTCGAACTGCCGTTAAGGGGGGCACGAGGCTCGGTAGCAG
CGCAAACACGATTCTGGCGCCTGTCCAAGCAATGCTCAAGTTTGAAATAGTGAGGCTGATACGCTCTTTCTCGAAACGCA
TTAGAATTTCAGTCATTTCTAACAGCTCATGTTTTCTCTACTTAAGAAGCAACACCCTGAACGTCTAGGATCCGGCATGT
TTTCGGTGGGAACGCTTTTCAAAAAGCTGAAAGAGTTCAAAAAACGCATGGCCTCCGAGAGCCAGCACACCTTCTACCTT
GCCAAGGTAGATGTCAAGTCGGCCTTCGATACGATGCCACAGGAAGCAGTGGTTGAGCTGGTGCACAAACTTTCGTCTCA
CCGGGCATATTATATGGACAAACATGTGGAGATGGCAGCCCCTGAGAACAGAGGACTTGGAGGCGTCTTTAATGCTGCGG
TCAAGGGCGACTTTGTCCCGATGCGTCGGTGGAAGACAATAGCCTCGGCGAGCACAGATGCGTCGGGCTTTCACGATGTG
GTGGAGAGCAGCTTGGCGACGTATCAGCGAAATGCCATCTTTGCGGACACAGCCTACCGGAAACCCCGAGATTCGGCTTC
ACTGGTAGGACTCGCGGCGTCCCACATTCTTCAAAATCTCGTCAAGATCGGCAAGAAGTTCTACCGGCAGAAAACGGGCA
TTCCGCAAGGGTCGGTCCTTTCGGCGTTGCTGTGCAACTGCTTCTATGCGGAACTGGAAGCAGAGGAGTTGGGATTTCTG
GACGCTGACGGCAGCAAAGGCTGCCTCCTGCTGCGTCTGATTGATGATTTCTTGCTGATCACCACAGACCAGAGCAAGGC
CGCTCGCTTTGTCGAGGTGATGCACCGGGGCTTGCCGCAGTACGGTGTCGCCGTCAGCTCGGACAAGAGTCTGGTGAACT
TTGACTTGCAAGGCCCTGACGGAAAGTCCGTTTCGCGAGTTGCCAACGGTGCATGGTTTCCCTACTGTGGCCTAGTCGTC
AACTGTTTGACGCTTGATATTGCTAAGGACTGGGAGACGAAGAAACAAGGTAAATTATTTAACCATTTGTCTTGTAGCCG
GGATCTAACACGAGTGCTAGTTGTGTTCGATACGCTCACTGTAGAGCATGCACGATCTCCCGGACATAACTTCAAGAGGA
AGATATTCAGTATGTATTTGACGCGATTTTGTTGCTCGTCATCTTTGCTAACCCTCCCAGACGGCTTCAAGGTCCTTTCC
CACGTCATGTTCTTCGACACAGCGCACAACTCATTGCGAACGACACTGTGCAATGCCCATAAGGTGTTCTCGGATACGGC
GGTCAAGGTGTGGGCATACACACGGTGCCTGCCAAGAGATAAACGGCCGAGCACAAGGCTCGTCATTAGCACCATCGAGG
AACTGTCCGAGCTTGCATATACTGTTCTGAACGGCAGAGCCCGGCGAATGCCCGAATATCAGTTTTCGGTGTTTAAACCA
CAGCTTCGGTGGTCCGTCCTCCTTAATGGATTTCCACATACACACATGCTGATTTGATCTCCATTCAGGCTGCTTCTTCA
TGCATTTTCCGGTGTGCTCGGGAAGAAACAGGCCGGCTACAGCGATGTTCTTACGTGGATTCGCAGTGAGATGCACTATT
TGCGAAGCCAGCAGGACTTGCGACTACCTAAAATATTTATTGAGACCTCGGTGCAGGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62