GenePrediction:GLEAN_4487 Details

Name: GLEAN_4487
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:452601..451211 (- strand)
Length: 1391
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:452601..452404 (- strand)
Length: 198
Type: CDS
Source: GLEAN
Position: GCSC_161:452330..452294 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_161:452234..451725 (- strand)
Length: 510
Type: CDS
Source: GLEAN
Position: GCSC_161:451667..451605 (- strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_161:451548..451211 (- strand)
Length: 338
>GLEAN_4487 class=GenePrediction position=GCSC_161:452601..451211 (- strand)
ATGGCCTATCTGCCCGCCTTGCGGCTGGCGGCGCGGGATGCCATTGACGACGGCGTCTCCAATCCGCGCGGCGAGAGCCT
TGCCCGGCTGGCCGTCATCTTCATCTGCATCTCCGGCATCATCGTCGTCGCCCGGCTGTGGACGCGGTATTCGAGCAAGT
CCCTTGGCCCCGACGACGCCCTAATTGCGGGGTCCCTGGTGAGACATGAAACGTTGACCACAAAGAAGAATCGAGGGACG
GCAGTGCTGACGATGACGCGCAACACGACAGGCACTTGCTATCGTCATGACCGTCACGTATAACAAAGGTAGGACGGCGC
AGACAAAAGAAGATTGACACACAGGAGGCTGACCGGACACCCTGTAGAGGCTAAGAACGGCTTCGGCCTCCACAGAGACC
AGGTGGACTGGTACCACAAGATGATCGCCTTCAAGTGGTTCTTTGCCGCCCAGATCCTCTACAAGATCGCCACGTGCCTG
ACAAAGATGTCCATCTGCGCCCTGTACCTGCGCATCTTCCCCAGCCGCCGCTTCCACTACGCCGTCTACACCGTCATGGC
CGTCACCATCACGTACACCATCATTGCCGTCTTTCTCACCATCTTTGCCTGTCACCCCATCTCCAAGTCGTGGAACAAGA
AGCTGGAAGGCACCTGCATGAGCTCGCGGTCCATCTGGTACTCCACCTCCATCATGATCATCCTGACCGACTTCTTCATC
ATCGTCCTGCCGCTCCACCACATCCGCAGTCTCAAGCTGCCCCTGGTCAAGAAGATACTGCTGACCGCCCTCTTCGGCCT
CGGCGTCTTTTGCATTCTCTGCACCATCATCCGCATGGTCACCGTGTCACCTCGGACGACTGCCGCCGATCAGATCTGTA
AGTCGATCGGCCGAACCTCGTCCTGGTCTCCTCCTTGCTGACCGTCCACCACAGACTACCAGGCCACCTCGAACAGCTGG
ACGTTCGTTGAGGTCAATGTCGGCATTATCTGTGCCTGTCCGTATATCCTTTTCTGCCGGGAGTTGCGTCTTGTGTCCTG
ACTCCAGCTCTAGGCCTCCCGATTCTTCGGCTTCCTCTTTCCAAGTCGCTGAGGCAGATACTCGGCCTCTCCGTCAAGGG
ATCAACCAATCGGTCAAAACCGACAGACGCCTACGTTCTGCACAGCGTCGGCAACGACGTCCGTTCCGGCCTGGCCTCGT
CCAAGACCAACAACGAGAACGACAGCGTCAGGGAGCTGATTTTCGACAAGCATGGCATCAATGTCACTCGCGACTTCAGC
ACCAAGATCACGTCCGACGTGGACGGCCAGGACCTACAGGTTCCATCGCATAAGAACTCAACTGACAAGGCCTGGTCGGT
CGAGCCGGACGGCCCCAGCCACAAGCATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62