GenePrediction:GLEAN_4488 Details

Name: GLEAN_4488
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:450328..448151 (- strand)
Length: 2178
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:450328..449533 (- strand)
Length: 796
Type: CDS
Source: GLEAN
Position: GCSC_161:449470..449242 (- strand)
Length: 229
Type: CDS
Source: GLEAN
Position: GCSC_161:449179..448337 (- strand)
Length: 843
Type: CDS
Source: GLEAN
Position: GCSC_161:448271..448151 (- strand)
Length: 121
>GLEAN_4488 class=GenePrediction position=GCSC_161:450328..448151 (- strand)
ATGGACAACCGAGAGAGAGATGCTCGGAACTACACACCGCGCTCGCGAGATGCGAGCTCGCTCAACGATGTTACCAACAG
CTCGGTTCTTCGCCACGCCCTACGCGAGCGCCGGTTTGCTCGCAACCGCAAGGCCTGCTTGCCCTGCCGAGAGCGCAAAG
TACGATGCGACGGCTCACTGCCATGCCTGACCTGCAGCAAGCGCCAGCACCCGGATCTCTGCCAGTTCTACCAGCCCCGG
CCATATCCAGTCCAGCCAGATGACGGCGCAAGAAAGACTCCGGAAGCAGCACCCCAGAAATGGTCCTTATCGGCCTCTCC
CAGGACCGGAACCAGTCCCTCGATTCTGGGCGACAGCTCCATTCTGGCCGTGACGAGACAGAGCGATGCACCATCACACC
CCGAGCCCGACCGCCAGTCCGCGTTCGAAGACGGCATTCTCCCGCTCCTGGGGATTCGTGGAAGCAGCTGCCTGTCCACG
TCGAAGCACCGCCAGGACGATTTGTTCGTCGGGGGCGTGAACAACAGAGAGGCCGTTTTACTGTTTGAGACATACCGCCA
CAGCATTCACCCGTTCCGGGCCATTGTCTATGATCTGACAGAGGTGGAAGAGTTGATGTGCTCGCTTCTGGACCCCTGTA
TTGAGCCACAAGGCCGAGGGACCCCCGACATTCCAGACGCTATTGCTTCGCGGCACACCATGCAACTCCGCGCTCTGCTT
CACGCCATACTGGCCTATGGAGCCCAGTTCTCAGACTTCCCTGTCGACAGACGGATCCAGTTGACCCAGAAGCATCGTAT
GCATCCCATTTTCTATCTGTCGACTGTGCCTAGCATGTTTTCTCACAGAACGATGCAGTGACATATACTCTCAACATCTT
ACGCAGCGTGCAATACCTCTCCAATCCCAGCAAAGAGACTCTGCAGACGCTCATGGTGCTGGGATGTGTGCTCCAGAATG
ACATGCAGCCGCAGGCTGCTTGGATGCTCGGCGGTACCACCATTCGGCTTGCCATCTTCCTCGGTATAGACAAGCGATCC
AACCAGTACACATCGGGCATATCCCCCGAGGAAGCAAAGTTCTTGCGGTACGTGCCTCCTGATCGTGACTGTTGTGCATC
ATGTTATGGAAGCTAATCAGAACGCGCAGGCTAGCAATCACATGGCAGGATTCCCTTCTTTCGTTGGCTTTTGATCGCCC
GCCAGCAACGTACGAGATGGACCATGAGGACGACTTGACTCCGCTGGACATGGCCAATATAGGGACCCTGAACTATCGCA
AGTGCATAAACTGGCTCAGCCATCTGACCCTGCGGCATTCTTCCGCTCTTCGATCAGGTTCTTCCATGTCTAGCAAGCAG
TATATGGAGCTGTTTGAGCAAGTCGACGCTATGGACAAGTTTCTCATGCCGTATCTACAGGACCGCCAGATGTGCTCTTG
CTTGAAAGAGGTGCAGGAGTACTACGGACTTCAGTTGCACAGGAACTTCCTTCTGTCCACTCTCTGTCGACCGCTGCTGT
CTAGCAGGGTGCGTTCGTGCATGTCCGAGGACGATGCCAACGCCATTCTGCAGCGGTTCTACGTATCGCTCAGACATGGC
GCACGTTCCTTTTTACATCTCCGCTCCATCACATGTCAGGCGAAACGATCCTGGGCCTTTGTTCACAACGGTCTGACCTC
TGTTCTTCTCCTCAGCTTCATGAAAGAGACCCGAAATCTGGAGGAAACGAAGCAAATGCAATCCGAGCTGCTGGAGAGTC
TCATGGAAGAAGACGACTGTGTTGTCAGCGGCCGGGAATCCGGACCTCTGACGCAATTGTCCACGACACACCAGAAAGCC
GTTCTAGCCATCCAAGCACTAGCGAAATTGACGAAAGAAGAAACCACGACGACAACAGAGGACCTGACAGCCCCTCCTTT
CACATCACATGGACCAAATGCGGATGACGCGCCGGCCCTGCCGGTGCTGCCGGAGGAAGACATTCAAGCCGGGTTTGTTT
TACAGTCTCCAGTTTTAGGTACAGAACCGATGCTGACACTCGATCCCACCTATCTAGGACTCTGGACATGGATGAGCTTC
TGCGCAACATTGATTATAACTGCTACTCCCCTCTGGAGGCCCTTGATTTTATCTTGTCCGACCAAAGCATGTCTGGACAG
GATGCTTTTTTACTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62