GenePrediction:GLEAN_448 Details

Name: GLEAN_448
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1833908..1835671 (+ strand)
Length: 1764
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1833908..1834216 (+ strand)
Length: 309
Type: CDS
Source: GLEAN
Position: GCSC_167:1834342..1834791 (+ strand)
Length: 450
Type: CDS
Source: GLEAN
Position: GCSC_167:1834850..1835671 (+ strand)
Length: 822
>GLEAN_448 class=GenePrediction position=GCSC_167:1833908..1835671 (+ strand)
ATGCTCGTCTTCCTACTGGCTCTGCTCGTCCTGTGCCTCTGCGTATACAGACGCTGTTTCCACAGCCTCGCTGCCGTTCC
CGGGCCACCGCTGGCTGCTGTCACCGGTCTCTGGTATGCCTACCATGTCCGCAACGGGCACATGCTGCGTCTCGCACAGA
CACTGCACCAAAAGTACGGACCCGTCGTTCGTGTCGGCCCAAATGAGCTCTGGTTCGACTCGGCCGAAGCAGTCAGACTG
ATCTACAGTACCGCTCTCCTCCCCTATGCTTCCGGTAGAACAGCATTGACGCCAGAGCAGATCCGAGTCATGGCTTTGAC
AAGTCCGACTTTTACCGTAAGTCCTCTCTTCTTCTCGGCAGCCTCTCCTTTCTCGGGCAGACCTGACCGACAGTGGCGAC
GGCCCTCTTCCGGCCACTGACCAGCTGGCGCCACCCCCTCCGCCCGACGTCTCCGGACACGCTGGACCTGCTGTCGGAGC
GCAACACCAAGCGCTACCGACTGCAGCGCCGCCTGATCGGTCCCGTCTACCACGAGGCCAACATGCAAAAGTTTGGCGGC
GCCGTCGACGCCGTGCTGCAGCGTGCCGTCGCCGAGCTGCAGCTGCTGGACGGCGCTCGCGTCGACCTCAAGGAGTGGAT
GCACATTATCGCCGTCGAGTGTCTGGGCGCCGTCGTGCTCTCATGGTCGCCCGGTTACATTCAAGACCGGTCCGATCATG
GCTCCAGCGCGGCCGGCTACTACAATTGGCGCCGCAAGAGCGTCTTCGGCCTCTTTCCCGTCCTCGTCCTCGTCGACCTG
CACTCACGATGGGTCAGCCGTGGCTTCGCTGCCGTCTGGCGTCTCAACTACGAGCGAAGGGCCGACTACAAGCCCTTGTT
TGCGGTATGTCAGGCAATGCCCTCGAAAAAAACGAGCTCTAACTCTCCAGGCTGTCGGACAGCGCGTGGCCATGCGGATT
CGCAGGGCCCTGCGGCCCAAGGTCCGACCGGCGAGCGCCAAGCAGTCTCGGAAGCCATCTCCGGCGCCTCGACGGGCCAA
CGACCTGATGGCCGACCTGCTGGACTTGCACGAGGCCAAGCCCGCCTTCAACGAGACGTACCTGCGCCGTCTCGCTGTCA
CCAACTTTGGCGCCGGTCACGAGACGCTGTGCTCGGCCCTGACGGCCATCGTGGCCATGATTGGCTCGCACCCCGACGTC
TTCCGTCGCGTCGCCGCCGAGATCCGCGAGGCTGCCACTGCTGCTGCTGCCATCACGTCGGCTCGTCATGTCCACGACCA
CCTGCCGCTCACGTGGGCGAGCATCCGTGAGGCCCAGCGCCTGCATCCAGCCATTGCCATGTCATTGTCGCGAACGGTCC
CCTCCGCGGACACGGGGCCTCCACTGCGTCTGCATGGTCATGTTCTGCCGCCAGGCACGACGGTCGGCTGCAGCCCGGCA
GCCCTGCATCGGAATCCGGCCATCTTTGGGGCCGACGCAGACGTTTTCCGCCCCGAGCGCTGGCTGCTGCCAGACGACGC
CGACGAGGTCCAGCAGGCCCGGCTGCGCGACATGGAACGCCTCAGCCTCGTTTGGGGCGGCAGCTCGCGCACGTGTCCGG
GTCGCCACCTTTCCGAGATGGTCCTGTACAAGACCGTGGTCGCGCTGTTGGCCGCGTTCGATATCGAGGCCTTTATGCCG
TCCGACGACCAGATCCGCTACTACTTCCTGGCCATGCTGACGGGCGCCCAGGCAGAATTCCGGACGCGCGAGCAGAAGAG
ATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62