GenePrediction:GLEAN_4490 Details

Name: GLEAN_4490
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:437444..433079 (- strand)
Length: 4366
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:437444..437220 (- strand)
Length: 225
Type: CDS
Source: GLEAN
Position: GCSC_161:437138..435956 (- strand)
Length: 1183
Type: CDS
Source: GLEAN
Position: GCSC_161:435893..435661 (- strand)
Length: 233
Type: CDS
Source: GLEAN
Position: GCSC_161:433822..433079 (- strand)
Length: 744
>GLEAN_4490 class=GenePrediction position=GCSC_161:437444..433079 (- strand)
ATGTCGTCCTCGGTGACTTCGCCGGACGAAACAACCTCTCTTCTAAGAAGTGCAAACCCCGAGTCTGAGCCGACATCCGC
GCCGATCGCGGCCACATCGAATGATCTGGAACATGGAGGACTGCTAGCCAGTCAACACGCCGCCACGGCTCCTGGCCATG
GCCACGGAGTTCACAAGCGGCGACAGCCCAACATCTTGGTCATCTTTCCGGCCATTTCTATCGGCGTGAGCGCTCTCTCT
CTGTCCTCCTGCTGGAAGACTGCTGTGAAGGCACAACCTCGCTGACCTAGGCCTTGATTGCAACAGACCTTTCTATCCGC
CGCAGACGGGACCATTGCGCTGGTCAGCTATGCTACCATCTCCAGTGAGCTGGACGCCCTGAACCTGGCCTCCTGGATCA
TCACCGCATACTCGCTCTCGCTTGCCTCCACACAGCCGCTCTACGGAAAGCTGTGCGACATCTTTGGCCGCAAGCAGTGT
CTGCTGTTCTCGTATGTCCTCTTCGCCATCGGCTGTCTTGGCTGTGGCTTGGCCCAGACCATGGAGCAGATCATTGCCGC
GCGTGTCGTCCAGGCCATCGGTGGCGGTGGCATGGGCACGGTGGTCTCCATCCTGCTCACCGGCCTGGTCCCCCCCGAAG
ACCGGGGCATCTGGCAGGGTGTGCTCAACGTGGTCTACTCTCTGGGCGCTGGCCTCGGTGCCCCGCTCGGCGGCCTGCTG
GCCGGCTCTGTGGGCTGGCGGTGGTCGTTCTACGGCCAGGTGCCCATCTGTGTGTTGGCCATTTCGGTTGTCAGCTGCTT
CCTCGATGGAGACATCGGCCAGGACAAGGAGACCCGCCTGGAGCAGGAGCAGCAGGAACAGGAGCAGCTGCAGCAGCAAC
GTCGGGCAGTCGGACGTGAGTCGCTGTTGTCGAAGCTCGGCCGGGTCGACTTTCTGGGCTCCAGTAGCCTCGTCGTCGCA
ATCGCAGCCTTTATGCTGGGGCTCGACCGTGGCGGCAACGTGTCCTGGACCGCCGTCGAGACGTACGTCTCCTTTTGCGT
CTCGGCCGTTGCAACTGTCTGGTTCGTCTACGTCGAGGGTCGTATCGCCCGCGAGCCGATTGTGCCCATGTCTGTCGTCC
GCAACCCCGAGCTTCTGCCCATCTATCTGTCGTCGTTCCTGTGCTTCTTCGCCCTGGCTGCCCTCGAGTTCATCCTGCCG
CTATACTACCAAGTCAAAAAGGAGCTGACGCCACAAGAGGCGTCTCTCTACATGATCCCGGCCATCATCGCCGGTGTTTT
TAGCGCCATGGCCGTCGGCTTCTGGATGCGGCACACCGGCCAGTTTTACTGGGCCCAGATGCTGGCCTTTGTCGTGCAGG
TCGCTGGCACCCTGATCGCCTTCCTCTTTTCCGGCACTGTTTCTGAGTCTGTTCCTGGCTTGATAGTCGCCCACATAATG
AACGAGCTCGGCATCGGAAACTCGGTCGTCTCTGCGCTCATCGCCGTCAGTAAGTGCAACGTCTCCATGATTAGACCCCA
GTTAGTTCCACGCTAACCACACGATACCCAGTTACCAATGCGTCTACCAATAGCGTGGCCGTCGTCACCGCGTCCTACTA
CGCCTGCCGAAGTCTGGGCTATGTGCTCGGCGTTGCTGTCGTCTCGACTGTCGTGCAGCAGTACCTGCGGGATGTCCTGC
GTATCGAACTCCAGCACTTTGATGTGGATGTGGATGCTATCGTTGAGGACGTGACGAAGAGCCTGGATTCTCTGCAATTT
CTAAGCCCCGAGATCGCCGACATTGTAAGAGACTGCTACGGTAAGGGTATAAACAGGGGGTTCCTCCTAATTTTCGCCGC
AGCTGTTGTTGGTGCTTTCTGCGGTCTATGGATACGCGGAGGAAAGTCCCGTCGGCGATGAAAAATGCAGGGAATAAAAA
GATGACCTACGTCTTTCTTTAGACTGTCTGAGTCTTTTGGTTGATGTCGGATGCCAAATGTGCCAAAAGCGGCGGAACTG
AGGATCTCACGAACCGTATTTTCTCTCTTATATCTATTGCTTCTGATCTGTAAATCTATAAATGTATTTAGCGAGTCTGT
CACGTATTTTGTGTTGTTCTTTGGGGCATTGCCATGCTTATGTTGTGTCATTTCTTGGATCTGATAATCTGCAGCTCGTC
GAGTGCTAAATTGGTGGTGATCTTACCATTTGTCAGGATCGGGAAGTATAGGCAGTCAACGTGACAGATAGGCCAATATT
ATAGACATCCAAGGATTATTATTTTTATTGGTGGCGCTGGTTCTGATCATCTGTGAAAGCAAAAGTGCTTGTGAAGAAGT
TCATTATTTTCAAGGAGATACTGAGAGACTTAGGCTAAGCGCGCATGTGTCAATCCGACGAGCCCTTTAGTACCGAAACG
TTTTCAGGAACCGCCGCAGGTTGCGTTTTAGACACTAACCCAAGGATGTTGGACATTGCGACTAAAAGTTGACCAGAACC
ATAGAGCGCACAGAACGTGACACGGTGACTAAGCCCCCGCAAACGAGCTCATATTTCTACTCGTACGGAAAGAGCAAGAC
TCATTCAAATCAAAAAGTCTTCATATCGGAGACCAGGACAAAGCATCTTGTGCGCCTAGTGTAATGATCGCAGCTGCCCT
CTACAGCCCCATCTCGCGCACCAGCTGCCTAAGCCAAAGGTGATTGCCAGGCCAACACTCCGGCTTTTCTGACCTCCATT
TGTTCTTTCTTTGTCCAAACATCATCTCGACCCCCCTTCTCCCCCACAAACACAAATCTCGAAACAAAAGAAGCCATCAT
GGCCACTCCAACACAGATCGAGCCATCATCGGAGTACCTAAAGTTCTTGCGCGGCTTTGTGTATCCCGAGGACGAGCTGC
AGAAAGGAGGATTCACAGTCGCCCCACTGACTGAAGATGCTTTGTTGGCAAAGCGGCGTTGCATGCGATGCGGAATACGT
CGTATGCATATCTCTGCTTTACTTGACATTCCAACAAAACAAAGTTATAGACTGACTAAAATTTACAGCGAAAACACGCT
TTCGAGACAAGAGACCGCGGAACGTAGAGGATGCCACGAGCCAAGACATGAAAAATGATGAATCAGCACCAACCACCACA
GCCACGACAGGACTGCGTTCCTTGAGCCTGACAGAAAAGACGCATCATAAGCGCGGACCCAGAAGCAAGCAGGAGGTTTA
TAAACCCAGCGAGACGAAAGAACATCGCTTTCCATGTATTTATCACGCCGGAAAGCTTAAGTTTGTTGTTAGTGTGCCTA
AAAACATCCATCAAAGAAATGGGAAGACTGAGAGAGGGATAACAACTAACATCAAACTCTGAGCCCCAGTCCGGTTTTCA
GATGTGGACTTGCTGCCACCAGTCCAGAACGGCTAAGCCTTGCGCTATGGCTGAAAAGCACGAGATAAATGACATCCCCC
TTACTGATCTAGCTGAACGCTGGCAGTGCCATCCGACACCAAAGGTGCCTGTGCAGACTCGGCCTGCGAGTATGGGACTC
CCATCAGTTTCAGAAGTAGGTTCATTTTCTTTTGGAAGCATCCATCATGATAGTAGTGGCAGCCACCGACAGAGAAAAAG
AGCTGCTACGACCCTGGACCAGACGCCCAAACGCCTTGCCGTCGCCATCGACTGCGAAATGGGCACTTCCTCCGACAACG
ACAGCGAACTAATTCGCATCACTCTAATCGATTATTTCACGGGTGACGTCCTGATAGACAGCCTAGTCTGGCCGAGTGTG
CCCATGCTACACTACAACACTCGCTACTCGGGTGTGACGCGAAAGCAATTATACGACGCCCAGAGCATGCGGCAGTGCAT
CGAGGGCGTGGCTGCGGCACGTTCGCGTGTATGGCAATTTGTCGGACCAGAGACAGTGGTCGTGGGCCATGGGACTCAGA
ACGACCTGGCGACGCTCCGGTGGGTGCACAACAAGGTCGTGGACAGCTTCCTTATCGAAAACAAGCTTCGGGAAGCATAC
AAGAGGGCGAAAGAGGAAGAAGAAGCCAGGAAGAGGGAAGAGGAGGAGGCGAGAAAGAGAGAATTGGGGATCGTGGAGGA
GGAAAGCAAGGATGGAAGTGGGAAAGAGGAGGGCCGACAGAACAAAGACGGCAATATTGCAGACAAGAAAAAGGAGAAGA
GTCGCAAGCGTGGAGCAGGTGGCCTGTCACTCCAGGCACTGGTGTACACCCGGTTGGGACGAGTGATTCAGACTGGCAAC
AAAGGGCATGACAGCCTCGAGGATGCCGTCTCGGCGCGGGACCTCGTTGATTGGCACATTCGACAGGCCATGAATGGTGT
TGAGGTGAAGTGGGAAGCGCTAACAGATGGCCCTGACGCCAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62