GenePrediction:GLEAN_4491 Details

Name: GLEAN_4491
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:420920..420078 (- strand)
Length: 843
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:420920..420810 (- strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_161:420461..420078 (- strand)
Length: 384
>GLEAN_4491 class=GenePrediction position=GCSC_161:420920..420078 (- strand)
ATGGTCTCCTTCCAGATTGAGATTGAGAAGTGTATTCGCATTTCCGTAGACGGGAAACTCGCGTATCACCTTAGCAGAGT
TCGGAGTTCCGTCAACAACGAAGGCCATGATGTACTCTTGCAGCATTCCGGCCTGTGTATGATTCACAGTTCCTTCCCAT
CCCCACGACTCAATCCCATTTATAAAGGTCGGGCCGACATCGCCTGAGTGCAACCCCAAAGAGCCATTGTACCGAAAGTT
GTACGTCTTGTTGCCGAAGACTCTGTACAGCTGTGATGTATGGTAAATAAAGACATACTCCGTAATATCAAGTCGACCGC
GTATAGTAGTATATGGGAACGTTCCATTATATATGGGCGGAGCGGATACACTGCTGTGAGGACGTGTGTTACTCTATCGG
TGTCTGCATACGGCAAAAAAAATCTTTGAAAAATCGTGAACCTCGTCTTCCGTGTCAAGGTCGTCCTGCCGTTTTCTGTG
TCCAGGCGCCCAGTGACCGACGACGGGATTGACGCGCTCAACCACTTTATCCGCCGCAACGCCCCAGACCTCCTGGTGGC
CGACATGGACGGTGCCGACGAGATCATCCGCCACCACATGGCGGCGTTCTTCTGTGCCTCGCTGATTCATTTCGAGCGGC
GCGTGCGCAAAACGTCCTCGGCCAAGCTCCAGCGGCTGGTGCAACGAAGCCTCGGCCATCTCGAGTCGATCCGCGCGCTG
GAGACGGAAAAGGGCTGGGCCGTGTGCGGCTTCTTCCGGCCGCAGTTTGGCACACTGTGCGAGGCCGAGGACACTATAGC
CGGAGGTGGATATTTGCTAGCGCTCGCCTGTCAATTGCCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62