GenePrediction:GLEAN_4492 Details

Name: GLEAN_4492
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:418829..414316 (- strand)
Length: 4514
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:418829..418190 (- strand)
Length: 640
Type: CDS
Source: GLEAN
Position: GCSC_161:418107..418013 (- strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_161:417960..417826 (- strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_161:417072..416066 (- strand)
Length: 1007
Type: CDS
Source: GLEAN
Position: GCSC_161:415883..415735 (- strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_161:415679..414316 (- strand)
Length: 1364
>GLEAN_4492 class=GenePrediction position=GCSC_161:418829..414316 (- strand)
ATGGCGACTAGCATCACGAGGCTTCCGGTGGAAACGATAGGGGACGTCTTGCGCAGACTCGATAGCTTCTCTACGCTGGC
AGTCTGTATCCGCTCCAGTCCCGTCTTCTGGAGAGCCTTTCAGGAGAACTCGCAGGTTTGTCGCGACATTTTGAAATTTC
GGATAGGCCTCACACTGCTTCCCTATGCAATCGCCATCTACGAGGCTCGCCATCGTCGTAATCTGAACGTGTACACCGAA
GATGAAACGCACTCTCTGCTTGACGCGCTGTACACCGATCCTGCCAGTATTTCAAGGCGCTTGGCGAGGATCGACACAGA
TGGCCTGAAAGAGATCGACCGCCTGCACAACGTCGTTCAGCGAAGCGCCCATGAATTAGCAGAAAGAGCACTGTCCGTCA
TCGAGTCTGGCTCGGAAGGAATTGAGGTGGGCAGGATTGCATCTACGTCAGAGCTGCACCGGCTCTGTCAGGCCCTCTAT
CGTGTCGAGCTATACATGCAGCTCTTTGGCGCAAACGGGAAGCCAGAATGTCAGCTGTCATTTGAGCTGCAGAAGTCGTG
GTTTTTCGACCGACATCCGCCGTGGATGAATGAGCAGCTAGCCTGTGTCCACGATTTCCTGGAATGGAAATTGAGTCATT
GTAAAGACTTTTTCTCTTTTCTTCTCGAGGGTTTTCCTACCTCTTCCTTGCGGTCGGCAGTACTAACGAAGGCGCAAATC
AGCACTGCATCACCTGACCTTTGACGGTAAAGACTTTGATGATTCATTTTTGGATCGACGGCCAAGGGGCGTGGAGAATC
ACTGGATGCAGTGCTATGTGAGTTATCTGACTGCCTACGACTCATAGTACTACGACTGATACCATGCAGATGTCCCGCGG
GCTTCTTTTCATAGACGACCTCGAGCACGCCGATGCATACAGAACGAAAATACAGCTTCTGCTAAATGCCATCGGCTCAG
GAACAGCACGATTCGCCGAATCACTCAAATCGCTCTCCAAAGACGTAAGTAATAGTGACGAAGGCCAAAACTGTGCCCGC
ACCAATGATGACCAGGGTCCTATTGTTGTCTGGTCTGAGTTGCACAAGGACAAAACGGCATCAAAAACTATTTTTCTCGA
CAGAACCTACAACCTTCGGAAGACGGCATATGTTTTTTGGGACGAAGCTCGTGTCCGTAAGGATGACGGCCTACTTTACA
AGCGATTTCAGGGCATGGCTGGGCATAGCGAGTCTTGAGTCCGTGTTTGATAGAGGCTGTTGTTGAGAATATTACTATGT
ATTAATAAGACATCTGGGAGAAGCTATCAAATTACGGGTGCCCTGTGAGCATGCGTGTTGTTGTGATTAGGCATCTTCCG
AGAGATGCTGACCTGCACGAAATCCCCTACTTAAATAGGTGGGTCTAGGCGCTATACACCACCGGTGAGTAATTCTTCGC
ATTCTGCGCCACGAGACCTTACAGCCCACTCATTTTGACAAGCACTAAACTACCCGGGTTGCATGCTTTTAGCGATTTCG
GGCCTGTCTGCGGGGTGTGCTATCTACCGTCCCGGAACCGGGGCTAGTTAATCCGAGTTCTTCACAACTCTAGGCAGGCA
GCTGCAATCGGCCTAGAGCCATTGTTGGCAGCCATGAAGACATCACGATACTCCACCTCCCGCCAACTGGCATGCGACTC
TTGTTATAAGGCCAAAGCAAAATGTGCAGTCGTCCACGGGCACGCCTATTGCAACAAACGTTTACTCAACCGCTCAGTCT
GGCCAAACTGTTGTTCAAGAATACCTGCTAAGCGAGCTCATCTGCCCCATTGACGCGGCTGCCATCTCCGTCCGCTGGAT
GCACCCATACATTCCGGTACCAGAGCAAACATCCAAGACGTACTCCTCAGCTACGATGGGTTTTCTAAACCGGGTGCTAA
AGTCATACGCAGAGGTAGCAGTGCGCAGTCGCGGCAATCCTCCGTTTGTGCACAAAGCGCAAGTGGGACATCTTGCGAAC
CTGCGAAGCCTTGCCACGCCAACGATGGACATGTGCCTGCAAACAGTTAGCATGGCTGACGGCATATCTCCCGGAGGAAA
CTGTGCCCAACTTGTGGCCGATGTGCTGATTCGTGAAATGGGTGCTCTGTCTGAGCGTCACGGGCGAAACGAAGACAACG
AAGGAGCAATTCTAGAGGATGCACACAGTTCCTTGGACCGGCTCGCCTCTTTTCAGGCGTACCTTTTATATGTTATGGTG
CTCGTGTTTTACATCGATCCCGGTGGGGTGCAGACTCGCCCGTTTCTCCGCCACGCCGTCGTGGCGGCCCTGCAGCAGAT
GGCCAGCGCCAGCGCGTGCGACGGGCTCGTGTGTGCAGCCGAGCTTCGGCGGAAGCCTGAGAGGTCATCGTGGGCTGCCT
CTGTGGTTGCCGAGGCCAAACGCCGCACGCTCTTCACTCTATACCTGGTTGAAAGTGCTCTCGCGGCCCAGGATGGCCTG
CCGACCTTCATGGGCACGGAGCTGCGCGGGCTGCCAGCACCAACCGCCGGTGCTCTCTGGACAGCCACGACGCTGGATCA
GTGGGAAGCTGCCTACGGCGCATACGCAGATGATTGGCTTGTCGACGGCCAAGGACCCCTGCGCATCAAAGAGCTGTGGA
CACCGCCTTCGGACCTCGACGCAGCTGGCGTGGCGTGCAGACATCGGCGTGTCGACCGCTGGCTCCAGAGCGTCGACTCA
TTTGGCACGATGATGTATGCGGTGACGAGCCACACTCACGGCCCGTGAGCGTTGGAGACTGTTACAACGCCGTTATAATC
CACATATAAAAGTTGCCACGGACGCTGATTGGCTGGTCGGAGCTGAGAGTCTCAACTCCGGCGAGCCCCACCTGTTGGCC
CGCTATTTGAAGCACTTTTATAATACCCAGAGACCTCCCTCTATCTGTATCATCCAACCCCAATAGTCTCTTCCGAAGTA
ACGCCATGGCTGAAGAAGGGGAGCCTGGATTGGAAGAAAGGCCTCCGGCTTCCTCGACAGAAGAACAACCTTACAGCATT
TTTGACAAACGACAGAGGGCCATCATCGTCCTCTTCGCCTCTGTAGCTGCTACATGTGAGAGCCCCCGACGGGCCACAAA
CTACCACAATGCCGACTAACATATTTGCAGTCTCCGGATTTGCGTCCAACATTTATTTTCCCGCTCTTCCCACCATTGCC
ACCGACATGGACGTCTCGGTCGAGCTCATTAATCTCACCGTGACGGCCTATCTCGTTTTCCAAGGTCTCGCCCCCAGTCT
CTGGGGCCCTGTGTCCGATGCAAAAGGACGCCGTGTTGCCTATGCCGGAACCTTTCTCGTCTTCATCGGGGCCTGTGTTG
GCCTTGCCCTTGCGCTCAGCTATGCCGCCCTCGTCGTCCTGCGCTGTCTCCAGAGCACCGGCAGCGCCAGCACAATTGCC
ATCGGTGCCGGCGTAGTCGGCGATATTACCACTCGTGCTAACCGCGGTGGCCTCATGAGTATATTCCAGGCCGGCCTTCT
GGCACCCGTCGCCGTCGGTCCCGTCATTGGCGGTGCTCTGGCCGGATCTCTCGGCTGGCGCGCCATCTTCTGGTTTCTCG
TCATCTACGCTGCTGTCTTCCTCATCCTGCTGCTTCTATGCCTACCCGAGACCCTTCGTGCACTTGTAGCCAATGGCAAC
CACACACCCACAACGCCGTTTTCTCGTTATCCGCTCGTCTTTTATCAGCAGACTACGACTACAAAGTACGATCTACAAAC
AACCGACGTTCACGCACTGCAATCGAAGCGAGCTCACATCGACGTCACCGGCCCGCTACGTATCCTGTGTAGCAAGCAAG
CTGCTCTGCTCATTTTCTTCGTCGCCGTTTACTACACCGTCTGGCAGATGTCTATCACCGCCATGTCCACCCTGTTTTCG
GAACACTACGGCCTGGGCACCACCCAGATCGGCCTCACCTTTATCGCAAACGGCGTGGGCTGCATCGCAGGCACCCTCAT
CACCGGCCGTCTCCTCAACATAGACTACCAGCGCGTAAAGATCAAACACGACCTGCGACAGCCTACTATGTCTTCCGACT
TTCCGCTTGAGGAAGCCCGTCTTCGTCTCGTCCCCGTCATGGCTCTGCTGCAGTGTGCTGCCGTTCTTCTGTTCGGCTGG
ACCGTTCACTTCCCCCACCGCGTGTCTATTGCTGTGCCTATCGTTGCCACTTTTCTGACCGGCTGGACGGCCGTGTCCAC
CCAGTCCGTCGTCATGACCTACCTGGTCGACGTCTTTCACGACCGCGGCGCTGCAGCCGGCGCCAGCCTCAACCTGGCCC
GCTGTCTGCTTGCTGCGGGTGGTACCAGCTTTGTCATGCCGCTCATCCGTGCCATCGGAGTTGGGCCTGCCCTCTCGCTC
TGTACCGGTGTTCAGGCCGTTGCCCTTCTGGCACTTGCAGTGCAGTGGAGACGTGGACCGACATGGCGGCGGGAGGCCGA
AGCTAAGCAGGAGGCTAAGAGAAATAGATGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62