GenePrediction:GLEAN_449 Details

Name: GLEAN_449
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1838332..1839989 (+ strand)
Length: 1658
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1838332..1838444 (+ strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_167:1838508..1839318 (+ strand)
Length: 811
Type: CDS
Source: GLEAN
Position: GCSC_167:1839375..1839989 (+ strand)
Length: 615
>GLEAN_449 class=GenePrediction position=GCSC_167:1838332..1839989 (+ strand)
ATGGGTCTCTTTGGCAAGACGCTGATGACCACCAACTCCACATTCAATGTGTGGCTGTTGCTGTGGTCTGCGGGCATTCT
GTCCACGAGTCTGGGCTTTGACGGAAGCATGATGTGAGTCTTGACAGGCTTGTCGTCTAGAAGATGGCTTTGGCACATCT
GCTAATGCCCTGCCAGGTCGAGTCTCAACATTCTGCCCTCCTACACAGACTACTTCCACCTCGACACCACTACCCTGGCG
CTTCAGTCGGCTGCGTCGTGGGCTGGCAGCACCGTCGCCGGTATCTTCATGGGCCAGGTCGCCGATTTCTTTGGCCGCAA
GAACGGGCTGTTGATCAGCGCCCTGCTCACCATGATCGGTGCCATCATCCAGGCCTGCTCACAGAACATCGGCATGTTTG
TGGCCGCGCGCTTCATCGTCGGTATCGGCAACGGTGCCACCTACGCTTGCGGCCCGACCTATCTGGTCGAGATGTTCCCG
CTGCAGTGGCGTGGTATCGGCCTGGCCATCTTCCAGGATTTCTTCTACATCGGTGGCCTCATCTCGTCCGGCGTTACCTA
CGGCACCGCCAAGATGAACTCCACCTGGGCCTGGCGTCTGCCGTCGGTCCTGCAGATCGTGTTCATGATCATGGGCGTCA
TCGTTCTCCCGTTCATGCCCGAGTCGCCCCGCTGGCTGCTCTACAAGGACCGTCACGAGGAGGCCATCGAGTCTATCGCC
GCCGTCCAGGGCAACGGCAACCGCGATGACCCCATCGTCCTGCTGACGTACCAGGAGATTGTCGAGACGCTGAAGCAGGA
GGCTGAGGCCCACCAGAAGACCAACTTCCAGCAGCTGGTCAAGTCTAAGCAGAGCATGCGCCGTCTGATGCTCGTCCTCT
CCGTTGCCATCATCTCCATGGCCTCAGGAAACAACATTGTCACCTTCTACCTCGGAAAGATGCTGGACAACGCTGGCATT
ACCAACAGCACGACCCAGCTGGAGATTGTACGTACTTGTGCCTTGTAACTCGACTGTTACGCCGCATCCTCTAACATTAC
TAGAACATTATCTTGAACTGCTGGTGCCTGGTTGTCGCCTGCTGTGGCACGCTCCTCGTTGACAAGGTCGGCCGTCGGCC
GCTGGCCATCTGGTCGTCCGTGGCCATGACCGCCTTCCTCTTCATCATGGGCGGCCTGACCAAGCTGTACGGCGACTCGA
CCAACACGTCTGGCATCTACGGCACCGTCGCCATGATGTTCCTATTCATGGGTGCCTACAGCTTCGGCTGGACTCCGTTG
TCCCAGCTCTACCCGCCCGAGGTGCTCAACTACTCCGTCCGCTCTGTTGGCATGGGTGCCTACACCTTCCTGGCCAACGG
TATCGGCCTGATGGTCGCCATGGCATTCCCCTACGCCCTCGACGCCATCGGCTGGAAGACGTATATGATCAACGGCTGTT
GGGACGTCCTCCAGCTCGTCTTCGTGATCATCTTCTGGGTCGAGACCCAGGGCAAGACCCTCGAGGAGATTGATGAGATC
TTCGACGAGCGTGCCGCTACCGCTGGCATGGTGCACATCCAGGACGTCATTGAGGGCCGTGACGTCGACGTCGCTATCAA
GAACGCTCATGCCGTGTCTGTGAGCAAGGTTGATGAGGCTGGCGCTACTGCTGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62