GenePrediction:GLEAN_44 Details

Name: GLEAN_44
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:324966..328423 (+ strand)
Length: 3458
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:324966..325212 (+ strand)
Length: 247
Type: CDS
Source: GLEAN
Position: GCSC_179:325284..325421 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_179:325493..325571 (+ strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_179:325639..326033 (+ strand)
Length: 395
Type: CDS
Source: GLEAN
Position: GCSC_179:326466..327907 (+ strand)
Length: 1442
Type: CDS
Source: GLEAN
Position: GCSC_179:327959..328423 (+ strand)
Length: 465
>GLEAN_44 class=GenePrediction position=GCSC_179:324966..328423 (+ strand)
ATGCCGTCACCATCACCACAGCCACGACGGGCAGGTGTGGACGGGTTTTGGACGCCGCGCCACGGGGCGTCTGGCGGGAG
CTTCAGCGCGTACCGGTCGTCGACGCGATCGTACCTCGGACGGCTGCCGCTGTTCACGCGGGCGATCGTGGCGCTGATTG
TGGTCGTGTACCTAGCGGGCCTGCAGACGGTCTGGGATGTGCGCAGTTGGGGCGCGCTGATTCCCGACAAGACCGGCATC
ACGACCCGTATGTGGTGTATCTTCTGGGCGACGGAGAGGAAGTGACTGACATTTTTTGCGTTGTTTCGCTTCTCACAGTC
TACCGTACCAACACGTTCCCCTTTGTGCACCTGGGGTTTTTCCATATGCTGTTCAACGTGGTGGCGCTGACGCCACTGCT
GGAGCGGTTTGAGGGCGAGCATGGCACGCTGACGTCGGTGGCGCTCTTCTTTGGCCGTACGATGCCCCCCCTGTCCGGAT
TGGCGATGAGGATGAATGGTCGATGCTAACGATTGTGTTGTGCGCAGCCCTGTCTACGCTGCCGGCGGTTCTGTACGTCA
TCATTGAGCGGGTGCTGCACCTGAACACGACAATTATGGGGTCGAGGTATGTTGTTCCGGCGTGTTTCCTCGTATTTTGT
TTTTGTCGCTGTTCCTGTCGCTGACACGCGCAGCATCTGGGTGTTTTTGCTTCTCGGCGTTGAGGCGGTGCGCATGTGCC
GGACGCACCCGTCGTTTGCGGTGGGCACGGTGCACGTGCCGACGTGGACGACGCCGCTGGCACTCGTGTTCGTCACGTCA
GCGCTGGTGCCGCACGCCAGCCTGCTGGGCCACCTCTGCGGGCTCGCGGTCGGCTACCTCTGCGGGCTGGGCTACCTCAA
GTTCCTGGCGCCGCCCGAGTCGGTGCTGCGCTGGATCGAGGGCCGGCTCAATCTGCTAGGCCGGCTGCCGCGCTACGTCA
GCGTCGACCAGAAGACGTACGGCCGATTCGGCGTGCTGCCGACGACGTCGTCGGGGCCAAGCGGCGCAGGGCCGGCGATT
GGGCTTGTTGGGTCGACGCAACGACTCGGTCCTTAGGCGAGGGAGAACATCCACACGATGACACACATACACACATACGC
ATACGACAATAGATAACAGCGAATTTAATACGCAGAAAAGAAGGGAGGGTGGGATTGCAAGTTCTGTCGCAGACACGGCT
TTGTATATCGTACGGAGTACATAGTAGAGGAATATAGCATCCGGGCGTTTGTGCTTAGTAATCAACGAATAAACGGGAGT
TGCAACGTGTGCCTCGTTATATGCATACGTGAGTCGAATGCGCTAAGGTGAGAGCTAATTGGGAGCAATTGCGAATTGGC
GAGCATCTTTCTGCAAGGTCAAGAAGCGGTCGTTCAGCTGTCGTTACGATGCCGCATTTGTTATGTGAGTGTGTTTGGTG
TAGCGGGATCTGGGCCTGGGTGGGTGACAGGGTCGAGAGGGCATCCTGCTAACGAGACAGCCGTTCTGGCGCAGGTGCGA
GGCGACGGGCGGATGCTCAAGGTGCCGCCGTACCTTGCGCTGCTGTGTGTAGTGGTGGGGGTGGTTTCGCTGCTGGTGCT
GCCGCTAGATGGACAATCGCGACGGACGTACATCTCGGAGAACGCGCTGCTGCCGGGCCAGGTGCACACGTATTTTGGGG
GGAGCGACCAGCACGTGCTGCGAGCGTATCAAGCAGAGGTAGAGGGGCTGGTGCAGGCGAACGGGACGAACGCGGAGGTG
AACTCGCGGCTGGAGGGGCTGCTGGGGGGGATGGGGCTGCGGACGGGGCGTCAGGGGTACAGGTACGGGGGAAACGGGAT
GCCGGGGACATCGGCCACGGGCGAGAACCTGTACGCGATCCTGGAGGCGCCACGAGGCGACGCGACGGAGGCGCTGGTGC
TGGTGGCAGCATGGCGGAGTGCCGAGGGCGAGGCGAACGTGCAGGGCGTGGCGCTGGCGTTGGCGCTGGCACGGTACTTC
CGGCGATGGTCGCTCTGGAGCAAGGACCTGATCTTTCTGTTTCCGCCCGACAGCCTGGCAGGCCCGCAAGCGTGGGTGGA
CGCGTATCACGACGCGCACGACGGACGGCAGGTGAGCGCGCTGCCGCGCAAGTCGGGCGCGCTGCAGGGGGCCGTGGCGC
TGGACTACACGCGGGCGGGCATGAACGGCGGGCAGGATCTGCCGGCCGGTCCGGATGGCCGGCCGGCCAGCCGCTACAGC
GACACGCGGTTTTCGGCCGTGCACGTGGTCTACGACGGGGTCAACGGCCAGCTGCCCAACCTCGACCTCATCAATACGGT
CGTCGCCATCGCCGGCGGCCAGATGGGCACGGCCGTGTCGCTGCAGCACGTCTGGCACCACGCCGACAGTCCGGCCGACC
GGCTGCGCACAATGCTCCGTGGAATGCTGCGGCAGGGCGTCGGGGCTGCCACCGGACCGCACAGCGCGTTCATGGCCTAC
CACGTCGACGCCGTCACGCTGCAGCCGTACGTGGCGACGGTGCGCACTCCCGCCGGCGACATCCTCGTCGATGGCTGGCT
TCAGGACGCCATGGCCATGGGCCGCATCCTCGAGGCCACCTTTCGCAGCCTCAACAACCTGCTCGAACACCTCCACCAGA
GCTTCTTCTTCTATCTGCTGCTCGGCCGGGAACGCTTTGTCAGCATCGGTACCTACCTGCCCAGTGCCATGCTCGTGGCC
GCCAACTTTACCATCATGGCCATCGGGTTGTGGCTCAAGAGTGGCCGGGAGGCCGGGGAGGAAAAGCTGCAAAAAGGCGA
CGACCGGGACCTCAAACACAACGACCACCAGCTCGAAACCCCGCCGGCTGAACGCGATCTCTACCTTCCCCTCGGCTTCG
TCGCCGTCTGCCAGTCCCTCGGCATCGTCCCGCTCTACGTCTTCAACCATCTGCCGACCTGGGTGAGTTTCTCTGTCCAC
ACAATCACTTCGTGCCCCTAACCTCCTACCTAGCTCCTCACCCCCGGCTTCGTCGCCTTCGCCATCGCAAATGCCCTGCT
GCCACACGTCGTCGCCCGCGTCCTCAACGCTTCCTACCGGCCCTCCACCCAGCAGTTCCGCCTCATCAAGTCCTTCTCGT
TGCTGCTGCTCGGCATGTTCCTCTCCTCGCTCGCCACCCTCAACTTTTCGCTCGCCTTCCTCGTCGGCCTGCTCGCCAGC
CCTCTATCGCTCATGGCTCCTGCCCCTCGTCGTACCGTTGTCCGCTGGGCCGCCACCCTGCTGCTCAACCTCGTCGCTCC
GCCCGCCGTCTTCGCCCTCGCCTGTGCCGCCTCTCACCTCCCGCTCGTCGACGCCCTGCGCACCGCCGCCTTTGGTTGGC
ACGTCTGGGGCATGTACACCGCCGTCGTCGTTTGGTGCGTCTGGTGGCCCGCTTGGCTAGTCGGCTCCGTCCTCGTGTTG
GGACAGCCAAGGGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62