GenePrediction:GLEAN_4504 Details

Name: GLEAN_4504
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:312367..310434 (- strand)
Length: 1934
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:312367..312317 (- strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_161:312238..312187 (- strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_161:312128..311473 (- strand)
Length: 656
Type: CDS
Source: GLEAN
Position: GCSC_161:311372..310434 (- strand)
Length: 939
>GLEAN_4504 class=GenePrediction position=GCSC_161:312367..310434 (- strand)
ATGGCAGCAGTAGCTCCATCAGGGGGCGGCCCATCCAATGCGGCCTTCAAGGTGCGTCTCCTTTGGGCGGGCGCTGGCTA
GCCCGTGCTCTTGTTGGCACCGTACCGATGCTGATGCTGACACGCGCAGGACAAGGAGAAGCCGGTGGCCGTTCGGTCGG
CCAACATCGTCGCCGCACGAGGTCAGTTACACCTGTCCAAGAAGGAGGGGCAACAGCAACTGACCTGTCCTCTCTGCAGC
CGTGGCCGATGCCATCCGAACCTCTCTCGGCCCCCGGGGCATGGACAAGATGATCATGAGCGGCAAGGGCGAGACGATCA
TCACCAACGACGGCAGCACGATGCTCAAGAGCATGGCTGTGCTGCACCCGACAGCCAAGATGCTGGTCCAGCTATCGCAC
GCTCAAGACGTCGAGGCCGGCGACGGGACCACGTCGGTCGTCGTCATCTGTGGCAGCCTGCTCGGTGCGGCCGACCGGCT
GCTCGGCAAGGGCATCCACCCGTCAGTCATCTCGGAGGCGTTCCAGCGCGCCGCTGCTGCTGCCGTTCACGTGCTGCACG
GCATGTCGCAGCCGGTGGCGCTGACCGACACGGCTGCCCTGTTGCAGGCCGCCAACACGTCGCTCTCGTCCAAGATCGTG
TCGCAGTACGCCAACCTGCTCGGACCCATGGCCGTCAACGCCGTCACCAAGACGATCGACCTCAAACAGGCTGACAACGT
CGACCTGCACAACATCCGCATCATCAAGAAAGTCGGCGGCACCATCGAGGACAGCGAGCTGGTCGACGGCCTCGTCCTGA
CCCAGCCCGTGCTCAAGAACGCCGGCGGGCCCATCCGCATGGAAAAGGCCCGCATCGGCCTGATCCAGTTCCAGCTGAGC
CCGCCTAAGCCAGATGTACGTTTTCTTTCTTTCTTTCTTTTTCTTCTTTTTTTTCTTCTTTATTTTCTTTCCTCTTTCTT
TCTTCCCTCTCGTCTCTCCCACTAACACCCCCCAGATGGAAAATACCATCTCCGTCAACGACTACCGCCAGATGGACAAG
ATCGTCAAGGAGGAACGCATGTACCTGCTCAACATGGCCAAGAAGATCAAAAAGGCCAAGTGCAACGTGCTGCTGATCCA
GAAGTCGATCCTGCGTGATGCCGTCAACGACCTCTCGCTGCACTTCCTCGCCAAGCTCAACATCATGGCCATCAAGGAGA
TTGAGCGTGACGAGGTCGAGTTTATCTGCAAGTCGACCGGCTGCAAACCGATTGCCGACATCGACTCCTTTACCGAGGAC
AAGCTCGGCAGCGCCGATCTGGTCGAGGAGGTCGCCAGCTCCGGCTCGCGCATGGTCAAGGTCACCGGCACGCTCTCCAG
CACCGCCGCCGGCTCGTCGGGCGCATCTGCCTCGGCCTCGTCGGCCAAGAGCGCCGCCGCTGCCGCTGCCTCCATCGCTG
CTGGTCACGGCTTCACCGGCCGCACCGTCTCCGTCGTCGTGCGCGGCGCCAACAACATGATTCTCGACGAGGCCGAGCGG
TCCCTCCATGATGCCCTCTGCGTCGTCCGCTGCCTCGTCAAGAAAAAGGCCCTCATCGCCGGCGGTGGCGCCCCCGAGAT
CGAGATCGCTGCTCAGCTCACCAAACAGGCTCGCGCTCTCACCGGCACCGAGGCCATCTGCTGGAAGGCCTTTGCCGACG
CCCTCGAGGTCATCCCCACCACGCTCGCCGAAAACGCTGGCCTGAACCCGATCAAGGTCGTCACCGATCTTCGCCACCGC
CACGAACGCGGCGAGATCAACGCTGGCGTCAGCATCAAGTCTGGCGGCGTCAACGCCAACATTGCAAAGGAAAACGTCCT
CCAGCCCCTGCTCGTCAGCACCAGCGCCATCGAGCTCGCCGCAGAGACCGTCAAGATGATCCTGCGGATAGACGACATCG
CCCTCAGCAGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62