GenePrediction:GLEAN_4505 Details

Name: GLEAN_4505
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:305515..304639 (- strand)
Length: 877
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:305515..305401 (- strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_161:305219..304639 (- strand)
Length: 581
>GLEAN_4505 class=GenePrediction position=GCSC_161:305515..304639 (- strand)
ATGACCACAAACGTGCTTGCGCACCTCTCTCTTCCAGGCGTGGTCTTTGCCAATCCGGCCGCCTCTGTCCTGCTGCCAGT
TGCCTTGGGTGCTGCTGTCGGCTACAGCACAAAGCGTGAGTGGATGTTGTGAGAGGAGAGCAGGGGTGACACAGAACGGA
CACAGAACGGACACAGAAAGCAGACCCAGAACTACGGAGTAGAATCACCCAGACCCAGAGCCACCCAGAATCACAAAGTA
CATCCACAGACACAGTCACGAAACCACAAAAGCTAACCCTCTCCATCTCCCTTCAGCCGACCCCAAAGACCGTTCTGTGC
GTGCCATCCGCCAGCCGCCGTTCCGTCCGCCGCCGGCCGCCTTTGGCCCGACCTGGACAGCACTCTATGCGCTGACCGGC
TACGCAGCCCACCGGGCTTTTAGGACTCTGGGTCCGGATCCGGCGCCATCCGTCCCGGCCGGGCTTTACTCGCTGCAGCT
GGGCCTTAACCTTGCCTGGATGCCGCTCTTCTTCGTGCTGCGGCAGCCAGTGGCAGCAGCCGCTGACGCGGTCACGCTGC
TCGGCATCAACGTCTTCCTGGCCGTCCGCTGGCTGCGCTCGACCAACCCCAGCACACGTACCGTCGGCTACCTCTGGCTG
CCGTACGTCGGCTGGCTTGCCTTTGCCACGTACCTCAGCGTCGGTGTCGGCCACCTCAACGGCTGGTCGTTCCGGCCGGC
AAAGAAGTCTTCGACATCGCCGCCGCCACCACCATCGGTTTCGTCGTCCTCGGCGCCCTCTCGTCCCTCCCGGGCATCGT
CCTCGTCTTCTTCGCCTTCGTCCTCCTCGGCAGCACCACACAAGGACCGCAAGGGCAAGGGTCGGTCGCGCAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62