GenePrediction:GLEAN_4506 Details

Name: GLEAN_4506
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:299487..298812 (- strand)
Length: 676
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:299487..299072 (- strand)
Length: 416
Type: CDS
Source: GLEAN
Position: GCSC_161:298997..298937 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_161:298847..298812 (- strand)
Length: 36
>GLEAN_4506 class=GenePrediction position=GCSC_161:299487..298812 (- strand)
ATGGCATCGCCGGCAACCGGTTCTCCCTCGGGGTACATTCAGCTCGCCAAGACACTGCCGCCACGGCTGCTGCAGTTTCT
TGCGCGATATCCACCCGCCGCACTGCAGCCGACGACGACTTCGGGCGATGCTGCAGCGCACACGTCGACGGGCTACCAGC
AGGACACGCCCAATCCTTTCAAGTCCATGAAGCACCCGGTCACGGGCCGCTGGCACGACCCCGTCTACTCGCTCCGGCGA
CAGGCCGAGCTGGCCAAGATGGCGCGGGACCACGGCGTGGCCGAGCTGCTGCCGGAGTCGAGCAAGAGCCCGGAGGAGCG
GCTGCGACGGCGCATCGAGCTGGGTGTGCGGGTCAAGGGCACCGGTGTCGGCCAGCGCGTCAAGGGCCACCAGCACGAGC
GCCACCTCGTCGCCAAGTACGTCCTCTTCCGGCGATTGCCGCTTTGTCCTCGTTTGTGCGTGCTCGCTCTGCTGACCGGC
CCCCCTCTAGGATGGAGGAACGGAGAAAGGCGATGCTCAACATGCCCAAGCTCATCCGGGAATGGAAACAGGTGCGCTGC
TGGAATGCTGCGGCTGTGTCTCTGTCAGGAGACGGCGGGATCAGAACTGCCATTGCTAACACAAGTCCCCTCGAAAATAG
GTCGGAAAGAAGAACTGGACACGGTACCCCAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62