GenePrediction:GLEAN_4508 Details

Name: GLEAN_4508
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:293757..293375 (- strand)
Length: 383
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:293757..293633 (- strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_161:293546..293375 (- strand)
Length: 172
>GLEAN_4508 class=GenePrediction position=GCSC_161:293757..293375 (- strand)
ATGCTCCACACACTTCCCATCACCGTCCGCCCGATGGTTCTGCGCCCTGTCAGCCGCACCTTTGCCACATCGGCTATCCG
CATGGCTGCCGGCGACACCGGTGCTCCCCCCAAGACGGGCCAGGCGTAAGTCGGACACAATGCATCGCAAGGCGTCGTGC
CATTGCCATTGCCATTGCTGCGCCCCGCTGACCTCTTTTGTCTCTCTCTAGTGATGCCTTCCAGAAGCGCGAGCGCGCGT
CGGAGGACTATGCCATTCGGCAGCGCGAGAAGCAGAAGCTCCTAGAGCTGAAGCAGAAGCTGGCCGAGCAGCAGGCACAC
CTGAACGCACTGGCTGACCATATGTTTGTGCTGCCCGAGCGTCCTCCCAAGGCCTCTGCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62