GenePrediction:GLEAN_4509 Details

Name: GLEAN_4509
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:290094..288433 (- strand)
Length: 1662
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:290094..290022 (- strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_161:289957..289580 (- strand)
Length: 378
Type: CDS
Source: GLEAN
Position: GCSC_161:289229..288433 (- strand)
Length: 797
>GLEAN_4509 class=GenePrediction position=GCSC_161:290094..288433 (- strand)
ATGTCGAAGCGGCGGGACAGTCTTCTGCCACCGGCGAAGACGCACACGGAAGACCCGGGCGCGCACGATCTCGGTGCGTC
TGTCGGGCCCCTTGTGCTTGTTGCTCGCACGAGCGAGACAGCGCTGACCGCCTGCAGAAACGGACGACGAGCACTTTTCG
GACGCCCAATCGGTGCCGGCCGGCTCGCCGCACAGCTCGCCCATCCCGACGACGCGAGTGGAAAAGGTCAGCGACGAGCC
GTCGTACGGCGAGGTGCCGGGCACGGAGGCGTATCGGCTGCGCGAGGGTGACGCTCTGCCCGACGAGATCACGATTCTGG
CCAACAAGGGCGAGGACAGCACGGTCGGGAGGCCCGTGTCGCAGCACGGACTCGTGCCGACGACCGTGTTGGAGGAAGCG
ACGGATGACGCAGGGGCAAAGGCCCCTGAAGGGAAGACGCACCACCAGGAAGACCCTGCGCCAGACCTGGTGGTAAAGGC
TGATGGCAGAGTGGAAGTCGGAGCAGGCACTACTGGTACGAAAGAGTAGACGGACACGTGTGAATCGGCTTTCCTTGATC
TTCCTGTCTCCTCCTCTTCTATGTTCTCTCATTCATTGTGTCGCCCGACCACGGTTATATTGACAGGTGTCCCGTAGATG
AACCAATATCACAAATCGTGACCCATCCTGCTTCCCGGCGACAGTCGTCTTCCAGCAGTGTACAGCAAAAAGAGATGCAG
GAGGATGCTGGGACAGGGTCCACACCAGATGCAGCTGTCGACAAGGAAGACGACGATTTCGGCGACGACTTTGACGATTT
TGAGGAGGGCGTCGAAGATGGTGGAGACGACGACGATTTCGGCGACTTTGACAGCGGCTTCCCAGAGCCAGCAGCACAGG
AGCCCGAAACGAGAGCATTGGGGTCAGCAGCAGCAGCGTCACAGCCGCCACCGCTGTCGTTTCCCGTGCCAGATTTCGGG
GGTCTCGACGGGGAAGAGGTGCTGCGAGCTGCGGCGCCGTACGTGAACGGGCTCTACGCGGCAGACGATGGCAGCAGCAG
GCTTGCGCTGCCGGCGCTGGGCAGCTCGGTCTTTCTGACGCCGCGGAGCGCATCGCTGTGGTCGCAGCTGGTGGCGCCGC
CGCCGCTGCAGCCGCCGGACTGGATTCGCAGCCGGATCCGTCGCCTCTTTCTCGTCAGCCTGGGCGTGCCCGTAGACCTG
GACGAGATCCTGCCGGCGTCCAAGCAGAAGAAGCTGGTGCTGCCGTCGCTGTCGGTGCGTCGCGACTCGCCGCGGACATC
GACCGACAGCCGAGGCGGCAATGGCAGCGGCAGCGGTGTCGCACGGCTCAAACAGCCTGGCGCTAACACGTCCAACACGA
GCGTCGACTCACAGGGCCGGCCGGCAGCCAACACGTCACGAAAGCGCAAGGGCCCACCACCACCGCCCGCGCTCGACCTC
GTGGCGGCTGAGCAGCTCTGCGCGACCACGGACGAGGCACTCGACGGCATGACCGACGACGAGCTGCGTGGCCACCTGGA
CCGGCTGCAGGCGCTCGAGCTGACGGCCAGGGCCGTGCTCGACTTCTGGACCAAGCGCACGGACGAGAAGATTGGCGACC
GCGAAGCCTTTGAGGGCGTCATCGAGAACCTGGTGGCACACGCCCGCAAGACGCGCAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62