GenePrediction:GLEAN_4510 Details

Name: GLEAN_4510
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:283574..281979 (- strand)
Length: 1596
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:283574..283167 (- strand)
Length: 408
Type: CDS
Source: GLEAN
Position: GCSC_161:283117..282650 (- strand)
Length: 468
Type: CDS
Source: GLEAN
Position: GCSC_161:282587..281979 (- strand)
Length: 609
>GLEAN_4510 class=GenePrediction position=GCSC_161:283574..281979 (- strand)
ATGGCTTCGGACGACAAGAAACGGCCGTCGGCTCTGAAGCTGGGCCCCAGCCGGTCCTCCTCGAGCGGCTCGTCGACCGA
TTCGCTCAAGCATCCCCGGACGCCTCGCTTTGCCGAGGCCACCACCGTGCACTCGCCCGTCGAGGGCGTCTCCTTCTTCG
CCGATGTCGAAAAGGGCGTGCGGATCCAGGCCCAGCCGGCCGACGTCGGCTTCGGCTACATTGGCAGCGGCGACGGTGGC
GAGACGGCCGCTGTGCCCATGACGCCCCGATCACCGCTCAAGAGCGCCATGAAGGTCCCGGGCACGCCTGGCCGGCGCTT
CGACAATCCGCTCAGCCCGACTTTTCGTGAAGAGCAGGTCCTCGAGCGGCACGAGGCCGACACGGAGAAGGAACAGGCCC
GCGATCTTGTAAGTCGTTTTTTGGACACTCTCACAGACAAGTCACTAACAAGCACAGAAAATCAAGACCCGCGTGCGCAT
GGCCAAGTTCGCCCTGCGTGGCGTCAACTTTAGCTGCAGCCTCATCGTTCTGTCGATGCTCTCGGCCTCGTTCAGCATCT
TCAACGCGACCAAGACGCTGCCCACCCAGAGCTCCTTTCCGCCGTGGGCCACCGGCACCAACCCGTGGGCGCAAAAGGTC
GTGCTCGCGGCCGCCTGCGTGTCCCTGACCGTCAGCATCCTCGTCCTGGCCAGCTACTGTCGCGGCGGTCACCGGCGCGC
CGAAAAGGTTTCCGTCTACTACACCCTCTTCGCCGTCGGCTGGTTCATCTTCAGCATGGTCATGTGGGCCATCGCGGCCG
GCATTCTGCAGGTCACCCGCAACAGCGGCAACAACAAGGACATGTGGGGATGGGCCTGCGTGAACAACCATCGGTCGCAG
ATCTTCTCGGACAAGGTCCACTACGCTCTCGTCTGCCGTCTGCAGGTCTGTTTTTCTCCTCTTCTTCTCTCTTCTTCTGT
CTCCCTTTCTCTTGCTGACTCATCCAGAATTGGTCGCTCATCTGCATCATCATCGAGATCGTCGTCGAGGTCATCAGCAT
CTCGCTGTACAGCATCATCTTTTACCGCTACTACTCCAAGCGCAAGCTGCACAAGTCCATGGACATGCGCGACAAGGCCC
GCTCCGACCTGTATCTGGCCCAGCTGCGGTCCCAGTCAGCCCCCAACACGCCTGGCTTCGGCCCCAAGTCTCCGGCCTTC
TCCCAATACGCCCTGTCACCACGCTTCCCGCCCCAGGCCTACGGCTCTCTCGGCAACGTCCAGGAGGAGGGCCCGTCGCC
CTTCACGCCAGGCGGCCGCAATCTGGTCGAGCCGGTGTCGGCCTTTTCGCGCCCGGCCGTCGCGCCGTCCTCATCTTTCA
GGCTGCAGGCACCGCCCGTCAAGGCGCCATCTGCCACGCCCAAGCTCGGAAGCGCCGCTTTTGCCGAGTCTGTTGTGCCT
GCCGCACCCGTCTACTCTCGGTCGTCGCCGTCGCCGCCACCGGCTGCACAGCAGACCATCCACGAGCACGGCCCTATTGC
GCCTGGCGAGGTCCAGTACGCAGCAGTCCCCATCCCCGGCGCCTATGCCGATGCGGTTCTGCACAGCCCGCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62