GenePrediction:GLEAN_4511 Details

Name: GLEAN_4511
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:277208..274897 (- strand)
Length: 2312
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:277208..276488 (- strand)
Length: 721
Type: CDS
Source: GLEAN
Position: GCSC_161:276420..275458 (- strand)
Length: 963
Type: CDS
Source: GLEAN
Position: GCSC_161:275399..274897 (- strand)
Length: 503
>GLEAN_4511 class=GenePrediction position=GCSC_161:277208..274897 (- strand)
ATGCCTGCCACATTTCGCTTTCTCGTTGCTGCTGCTCTCAAGATGCGTGACCTTCTAACCCGTCTGCCTTTTCAGCACGC
TGCCGAGGATGTCGCGCTCGATGCCAAGAAGCCACGACGGTCAGAGCGGCTTTCCCAGCGAGTCGACTCGACCGATGATC
TTGACAGCTCGTCGGCAGTCAAACCGACGGCCGCATCGACAGCCGCAGTTGCTGCGAAGCCTGTGCATCCAAAGACTCCC
GTCTCGAGCCGCTATCAGGTGCCCACGCCCCTGACCCTGCTCGCCACGGACGAAGCGTCCGACCAGCAGTCCAAGGAACC
GACGGCCTCTCCGCCCGAAGGCCGTCCCAGCCAGGTGGCACCGCGCGGCGCAACCAACGGCGATGTAGCCGGCAACGATG
CCACCGGCTCGTTCTCGTCGCCGCCCCAGGACACACAGGTGTTTCCGTCACAGAACGTCGACCCCAACTCGGCGCTCTCG
GAAGAGGTCAAGGACGAGGTCAAGGAGGGCGTCTGGGGCTACCTGTTTCCGCTGGGGACACATTACGGCAATCAGAGCCT
CGTGCTGAGGCGTCGCATGGCCTGTCCAGACGATGCGCCATCGGCCTCGTCGGCCTCTTCGGCAGCCGCACCGAACAAGA
AGGGCAAGAAGAAGGCGGCCAAGGACGAGGAAAAGAGTGCACATGCGGGCGGCTACTTGATAGGGCGGCACCCCGAGTGC
GGTACGTGTCCAATTCATCCGATTCCGTGCCGTTTTCTGTCCCTCATGCTAACAGCAGCACCGGGAAGATCTCATGCTGG
GCGACCCGATCGTTTCGAACCGCCACTGCCTCATCTTTGCCGAGCACAAGGGCACCGACACGGTGGCCGTGCTGGAGGAC
TTGTCGGCCAACGGCACGTTTGTCAACGAGGCGCTGGTGGGCCGCAACCAGCGGCGCGAGCTGCAGGAGAACGACGAGAT
CGCCGTGCTCGACCGGGCGCGCTTTGTGTTCCGGTATCCGCGCAGCCGAACAACCGGCGCCTTCCACCAGCAGTTCACGC
TGCAGCAGAAATTGGGCAAAGGCCACTTTGCCGAAGTGTTTCTGTGCGTGGAAAAGGCGACGGGCCAGCGCTATGCCGTC
AAGATCTTCACCATGCCGCCCGGCTTGGATGACCGGTCCAAGCTGGAGGGCCTGCAGCAGGAGATTGCCGTGCTGATGGG
CGTCAGCCACCCCAACGTGCTCTGTCTCAAAGACACCTTTCACGAGAAGGGGTCGGTGTACCTGGTGCTGGAACTCGCCC
CCGAGGGCGAGTTGTTCAACTACATTGTCATGCATCAGAAGCTGACTGAGGAGGACGCCCGCAAGCTGTTCCGGCAGCTC
TTTGCCGGCGTCAAGTACCTGCACGAACGCAACATTGTGCATCGCGACATCAAGCCGGAGAACATCTTGCTGGTCGACCA
CGACCTGCACGTCAAGCTGGCCGACTTTGGCCTGGCCAAGATCATCGGCGAAGAGTCCTTCACCACCACGCTCTGCGGCA
CGCCCAGCTACGTCGCTCCCGAGATCCTGGCCGACAGCCGCCACCGCAAGTACACAAAGGCCGTCGATATCTGGTCGCTG
GGCGTTGTCCTGTACATCTGTCTGTGCGGCTTCCCACCCTTTTCTGACGAGCTGTACTCGCGCGACTTTCCCTACTCCAT
GACCCAGCAGATCCGCGCCGGCCGCTTCAACTATCCGTCGCCCTATTGGGATTCCGTCGGCGACCCGGCATGTGAGCGGC
CCTGTCCTCTCCCGCTTCGCTTGCCTCGTTTTGTGTGCTGACAAGACAGTGGACCTCATCGACTGCATGCTGATGGTCGA
CCCGGCACAGCGCTTCACTGTCGAACAGTGCCTGGCCCACCCGTGGATGACCTCGTCGACGCCGAGTCTGACCGATAGCA
CGGACGGCCTGGTTGGCGGCGTGGCCGGGCTGCAGGTGAATCGGCGCGGCGGCGTCGCCGGTCTGGCCCGCGAGCGCACG
CTGCTGAGCGTGGCCAACTGCGTCAAGGTGGCCGAAGAGGTCGCCCGGGTCCCAGCCTCGGGCACCCAGGCGCAGCAACC
GCCGATCAAGATCTTCACCAAGAGCAACAAACCAGCCGACAAAGACAAGCGGGAAGCCCGTCCGGCCGACTTCCAGGACG
CCGGCGCCTTTATGGAACACGGCGACCGCGGCGATCCGGCCCTGTTTGACGACGACAGCATCGCCACCAGCACCATCGCC
AAGACCGACATCGGCTCGCCGGCCAAGGACAAGCCCAAGTCCAAGGGCAAGGCCAAAGGCAAGGCGCGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62