GenePrediction:GLEAN_4512 Details

Name: GLEAN_4512
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:268593..262441 (- strand)
Length: 6153
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:268593..265900 (- strand)
Length: 2694
Type: CDS
Source: GLEAN
Position: GCSC_161:265844..264320 (- strand)
Length: 1525
Type: CDS
Source: GLEAN
Position: GCSC_161:263767..263632 (- strand)
Length: 136
Type: CDS
Source: GLEAN
Position: GCSC_161:263519..263330 (- strand)
Length: 190
Type: CDS
Source: GLEAN
Position: GCSC_161:263215..262668 (- strand)
Length: 548
Type: CDS
Source: GLEAN
Position: GCSC_161:262582..262441 (- strand)
Length: 142
>GLEAN_4512 class=GenePrediction position=GCSC_161:268593..262441 (- strand)
ATGTCGACCAACTCCAATCGCATGTCTCGGCCAGGCCGCAACAGCCTCAACAACTCGCGGATGAGTGCTCGTCGGTCGCG
GGCACTCTCGCGCGGCACCCTTCTCGGCGATGTCAGCACCGAGGACGGCTACAGCTATGCCCTCCGCATCGCCTTTCTCA
ACTATCTGCTGCAGCCGAAGAAGAAACGGAAGGAGTACGTGGCGGCGGCGCCGAAGCCGGTGTCGCGGCGGTATTCAAGC
AGCGTGGGCGACATGATGAAGGAGTTGATGCCGGCCAGCTCGAGCTCGGGCTCGGGCTCAGGCCTGGGCTCAGGCTCGTC
GAGCATGAAGCTGCCGCACAGCTTCCGGGCGGCAATGGAGAAGCGGATGGAGGGCGTGCTGCGTGGAACGGAAAAGATGC
CGGGCTACAGCGACGCGGCCGTGAAGCGGACGTTTGGCGAGGCGTACACGGCCTTCACGGCGCTAGCGTTCCGCAAGAGC
ATCGACAAAGACCGCAAGATCGAGCCGCTGATCCTGATCTTCTACACAGCCAGCAGCAAGGCGCAGGGCCGCGGCAAGAC
AGCCGAGGAAGACGCGTGGAAGATGATGGTGGATCGCCACGTGGCCCTCTTTGTACGGCTCGTCAGCAGCGTGCTACGCG
ACCAGGGCAGCGATCAGAGCCGGCCGGAGCTGATGGCGCGGCTGGCATCGCTGGAGAAGAAGCTGCTGACCAATGACCAG
GACCTGTACATCGACACGGGCCAGGTGGGCGAGCACAAGACGATCGAGGTCGAGGTGCCGCTGACATACGAGGTCAAGGA
CATGCCGATGGTGCAGACGGTGGCGCGGCTGTTTGGACGGCCGCTCGAGGACGTGCAGGTGGACATTGACCGCGACATGT
CCGAGTGGACGGAGGAGGCGGCGCTCAAGGATCTCAAGAACTACCAGCACCGGCTGACGAGCAACATGCCAGGGGCGCTG
CGGCGCCAGGACTTTGACGTCGACAGCTCGTTTGAGGAGTGGAAGAAGACGGAGGTGCACCAGCTGACGCAGCTGATGCT
GGACGTGCTACGGGCACGGCCGGAGCTGGCCAAGACATCGTCGGGCCTGGCAATGCGGCCGACTTCGGTCTACTCGGAGA
GCCAGGCGTTCTCAGACCTGAGCCGGATGCTCTCGGCGACACCGGACGGCGACACGGGCGCGTCGATTGGCGGCAACGAC
CTCGGGGCCGACGGGACCTTTGGCTTCTCAGCGCTCTCGCTGGTCGACAGCATCGGCAGCGGCATGACCGAAGAGGACAT
GCCGGACTACACGTTCATCCCGCCGGACCCGCGGGCCTATTACCGGCTCATACTCAAGCAGGCGATGACGCACGACCTGC
AGCACCCCGATGATGCGGGCGCGATGGTGTCCGAGGCAGTGCCACTGCTGCGGCCGTCGACAGAGCTGCTGATAGAGCTG
GCGGTGCACTGGCGGCTGCCCCAGCCGTCGCGGTCGGTGCTGCTGCTGGACGTGGCGGCGCAGAAGTACTTGGAGGACGA
GCTGCCGGCCGAGGCGGTGTACGAGATCTTTGAGGACGTCAAGCTCAAGGCGAGCGTGGACCACCTGGCACACAACAAGA
AGGCGCCACACATTCAGCTGTTTGGCAGCCCGCTGCAGGACATGCCGCACAGCCGGTGGGCGCTGCAGGACTACACGGCG
TACCAGCAGATCCTGGGCAAGATGTTTGAGGCGATGCTGCGGGAGCTGCTGGAGGTGGCAGCGCAGTGCTACGAGGCGAA
GCCGAAACCGATTGGGCCGTCGCTGATGTTTATACGGGACCACTGCCAGGCCGACAGCGCCTTCTCGGAGCGAGCGGAGG
TGGTGGAGCAGTTTGCCGAGGCACTTCGGACAGCGATGTGGGAGCGGGCGGCAGCGGCGTACCGTGAATTTCTGGACAAG
AACATTCCGCAGCTGGAGGACGACTGGGACTTTAGTCATGTGGTCAACCTGGGCAAGGCAGTGGTGGGCCTGTGCGAGCG
GACACGCAAGCGGTACCGCAAGAATCCAGAGATCATGGGGGTCAGCCCGTTCAACGAGCTGGTGGTGACGGTATTCCCGA
GCTTCGAGCAGGACGCGCAGGCGATCATCGAGCGGGTTATGGAAGTGGCCAAGGGGCGGGGCGAGGAGGTCAACGTGCAG
GACGGCTTTGATCTGTACCACGAGCTGGTGGAGATTCGCAAGATCCACGTGGAGTCGCTGCCGGGACGGCCGTTTGCCTT
TCACATCGAAGGCCTGCTGGAGGACTTTGTCTGGCGGTGGATCCGGGGCGCACAGGAGCGGATGGAGCGGATCGTCGAGG
AGGCCATCAAGCAGGACCCGTTTCAGGTGCGGGCGCCAGCCGAGGATGAGGTGCCGACGGACGAGCAGCGGCACAGCGTG
TCGATCATGGACACATTCCAGGCCTTCAATCAGAGCGTCGACCAGATCTACCAGCTCGAGTGGGACGACGACGTGCACCA
CGCCACGTTCATGACGGCGTTAGCAAGCGCCTTTACCGGGGGCATTGGGCGGTACTGCGAGATTGTCGAACAGCAATTTG
TCAGCGAGATGGACCGGCCGTCGGAGCAGGAGCTGAGCGCGGCCAACAAGACGACGCAGGAGCGGTGGATGCAGTTTGCC
AAGGACGCGCTGAGCACGAAGGAGAAGGCGGTGCCATTTCAGTTTTACCCAGAGGTGAGTGAAGAGTGTGTTTGGAATGG
TATGGTCGTTCGACTGCTTACATAAGCAGTCATTTGTCAAGCTCAACAACATCGAATACGCCATGCAGGCTCTGGACAAG
CTGGAGAAGATGGTCAACGTGGACGGATGCGCCGAGGTGCTGCGACGCGAAAACGGACCGATCAAGCCAGTGGACCGACG
CAACGCCAAGTACGTGTTCACGATCAAGATTGTCGAGGCCGAAGACCTCAAGGCATGCGACCCGACCGGGACGAGCGACC
CGTACGTGGTGCTGGGCGACGAGTACCAAAAGCGGCTGGCCAAGACGCGAATCGTGATGCGCAACCTGAATCCGCGCTGG
GACGAGTCGGTGGAGATCACGGTGTCGGGGCCGCTCAACATCATCGCGACGATCTGGGACTACGACACGTTTGGCGACCA
CGACTTTGTGGGCCGGACATCGCTGAAGCTGGATCCGCTGCACTTTGGCGACTTTCTGCCGCGCGAGTTCTGGCTCGACC
TCGACACCCAGGGCCGACTGCTGCTACGGGTCAGCATGGAAGGCGAGCGCGACGACATTCAGTTCCACTTTGCCAAGGCG
TTCCGACACCTCAAGCGGACGGAGCGCGACATGGTGCGACGGGTGACGGACAAGCTGGTAGCCCACATCAACGAGACGCT
GTCGTACGAAGCCGTCAAGGCGCTGCTGAACCGGGGGCTGGCCTCGTCGATGGCAGCGCTGTGGCAGAAGCGGGCGAGCA
AAGCGCCAGCAGTGACGGCAGCCGAGGTGGAGAACGCGCTGCAGCCGCTATTCACGTACTTCAACGAGAACTTTGCGGTG
ATGAACCAGACGCTGACACACGCGACCATGATGGCGGTGATGACGCGGCTGTGGAAGGAGGTATTGATGGCGCTGGAGGC
GCTGCTGGTGCCACCGGTGTCGGAGAAGCCGTCGACGCAGAAGCCACTGACACAGCCGGAGCTGGATGTGGTCTACCGCT
GGCTCGAGCTGCTGTTTGACTTTTTCCACGCGCGCGACGAGAACGGCGAGGTGCTGGGCGTGCCGGCTGATATTCTCAAG
TCGGCCAAGTACCACGAGCTGGCCTCGCTCAACTTCTTCTACTTTGAGACGACCGAGAACCTGATCCGGACATCGGAGCG
GATGGCGGCCGCGACGGCGCAGCGGGCCCAGCAGCAGCTGCAGCAGCAGCAGCAGTTACAGCAGCAGCAAAACGCAGCGC
GGCCGCTGTCGGCGCCGCCAGGATTCCCAGGTTTTGCCGGGTCGGGAGCAGCGACACTGACGGCGAGCGCGTTTGCTAGC
ATGGGCACGATCCGACGCGGCAAGAGCATCATGATGAGCCGCAATCTCGGGACGATGCGCAAGGCCAAGGAGGAGAAGCG
ACGAGAGGCGCAGGCGGACCCGTCAGACGACATGATCCTGCGGATTTTGCGGATGCGGCCGGAAGCGGCCGGCTACCTCA
AGGAGCGATACCGTCAGAAGGAGCGGATGGCGGCACATCAGGCGGCCGCCCTGATTGTGCGGCAGAGCATCAACCAGGGC
TGGTCGGGGCCGGCGTTTGGGGGAGCGACGTACAGTCGAACATTGCCAGCAAGATGAGGGAAGTGAGGGGAGGAGATGGA
AAGGTGTGGGAGGTGAAGAGAAGGTGAGATGTGAAGTGTGAGGGTGATGGAAGTGCGAGACCGTTGAGAAACACGAGCGA
GGATGTATAATGCGTTCTGTCTTTCTTTCATCTATGCAGCGAATGTAGCTAGTTTTGGTTCGGCCGTCAGAAGGCAAATC
CGAGTGTTGTCCCGTACGCATTGTCATGGCAGCTGGCGAGCGGCCGTCTGATTGGCTGCAGGCAGAGCCAGCAGAGAATA
CGGAGTACGGAGTACAGAGAGCTACAACGTACGGCCGGCCAGCCGTCTTCCACTCCCATTTGTCCCCTTCCCTTGCCCCT
GCTGCCATCCACCCGTTGTCTCTTTGCCGGTGTTGTTGGCCGCGGTTGCGCCCAGGCGACAGTTGTCTTCGCTCCTCGCT
CTTCGCCCTCGGCTTTCCGGCTCAGCTGTCGCTTTTTGTCCATTCTGTCCTTGTTGTCCTTTTTCGGTCTCCTCTTTTCG
CCATGTTGGCCCTCTCGACCGGCCAGCTGGCACCAGCCGGGTGCCGGCTGTTGCCGGCTGCAGCCAGCCTGGCGGTGTGG
ACGTGGGCCAGGTGGCGCCGGCCACGGCAGCAGCTGCTGGCGACCCCACCCCCGCCCAGTTTTTCTCGCCCAAAAGCGGC
CGGTCAGCGGGTGCTGTCCTCGTTCCTGTCCTTTTCGTCTCTGTCCTCGTCTTCGTCCTCGTCTCTGTCTCTGTCCTCGT
TTTGTCTCCCTTCCATCCGTCGAATCCATTCAAGCACACTGCCCACCATGGCGTACACGATCCGCAAGATTGCGGCGCCC
TACACGCTGGAGCACCGGGTGTACGTCGAGAAGGACGGCCAGCCGGTGTCGCCCTTCCACGACATTCCGCTGTATGCCAA
CCCGGAGCAGACGGTGCTCAACATGGTCGTGGAGATTCCGCGCTGGACCAACGCGAAGCTCGAGGTGCGTGGTTTCTTTT
CTCGCTCGCTCGCTCGCTCGTTTTCCATCTCTTCTCTCCCCTCTCTTTGCTCTCTCTCTCCCTCTCCCCCCTCTCTTTTC
CTTCGCTAACCCCCCCAGATCTCCAAGGAAGAGCCCCTGAACCCGATCAAGCAGGACATCAAGAAGGGCAAGCTTCGCTA
CGTCCGCAACTGCTTCCCGCACAAGGGCTACCTCTGGAACTACGGGGCCTTCCCGCAGACGTGGGAGGACCCCAACGTGG
TGCACCCCGAGACCAAGGCCAAGGGCGACAACGACCCGCTGGACGTGTGCGAGATCGGCGAGCTCGTCGGCTACACCGGC
CAGATCAAGCAGGTCAAGGTGCTCGGCGTCATGGCCCTGCTGGACGAGGAGGAGACCGACTGGAAGGTCATCGTGATCGA
CGTCAACGACCCGCTGGCCCCCAAGCTCAACGACATTGAGGACGTTGAGCGCCACCTGCCGGGACTCCTGCGCGCCACCA
ATGAGTGGTTCCGCATCTACAAGATCCCCGACGGCAAGCCCGAGAACCAGTTCGCCTTCACGGGCGAGTGCAAGAACAAG
AAGTACGCCACCGATGTCATCCGCGAGTGCGCCGAGGCCTGGGAACGCCTCATCACCGGCAAGACCCAGCCAGGTAGCGT
GTCGACGTGAGTTTTTTTTTTTTTTCTTTCCTTTTTCCTTTTTTTTTTTTTTCTCTCTTTTCTTTCTCTCTGCACCCCGC
TAACTCTTCAGTGCCAACGTCTCTGTCGGCCACTCGCCCAGCCGCGTCTCCCTCGACCAGCTTCCACCTATCCCGGCCAA
CGAGGAGCTGCCGGCTGAGAAGATTGACGCCTCGATAGACAAGTGGTTCTTCATCAGCGGCGCCTCCGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62