GenePrediction:GLEAN_4513 Details

Name: GLEAN_4513
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:261636..260311 (- strand)
Length: 1326
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:261636..261356 (- strand)
Length: 281
Type: CDS
Source: GLEAN
Position: GCSC_161:261289..260311 (- strand)
Length: 979
>GLEAN_4513 class=GenePrediction position=GCSC_161:261636..260311 (- strand)
ATGGCCTCGCTCGAAGAGCTGCAGGGCCGGCTGGCGATGCTGCAGGAAAGCCTGGATGAGCTGCACGGGCTTACGGAGCG
GCTGGGCGCCAGCGCCACCGACGAGGATGTCGTGGCCGATCGGGCGGCCGAGATCGTCGATGGTCTCCGAGACGCGCGCG
ACGAGCACGAGCTGCTGCAGGAGGACGTGCTGGACCTGGCGGTGGCGTCGGGGACGGTGGTCGACCACGACCGTGCGCGG
CTGAAGGAGGGACTGGCCCGACTGGATCGAGAGCTGCAAGCGTACGTGCTTTCTGTCTTTTCCGTTCTTTGTTCTTTGTT
CTCTGCTTCTTCTCTGACCTCTGGCAGACACCATGCCACCTTTCGCCAGGCCCGGCTGCGCGCCCGCCAGGCTCTCGAGA
AGGCCCAGAGACGAGAGCAGCTGGCCATGCTGGAGGCCTATGCCGATCCCGCGAGCGACGACGGGGAGGATGACGAGGAC
GAGCGGTCCGACTCTGACGACGACGATGACAATGACATGTCCGATCCGACACACGCCCTCCACCGCCGGTCTACGGCTGC
ACGCAGCGCCCGGAAGTCGAAGCCGCCCAGCGCTGCAGCCGCTGCTGCTGCCGACGTGACGGCTGCCCTGCGCCAGACCC
ACGCCCGGATCGCCGGCGAGGTCGCGCGGTCCGACTTTGCCGCTCAGACGCTGGCCGAGAGCTCGCGCGCGCTGGCTGAT
CTGGGCGAGCGGTATGGCGGGTCCAGAGCAGACGGCGACATTGCGGCATCGCTGCGGTCGGCCCGCCATCTCGCTCGCGG
CCTCATGGCTGCCCACAAAAGCGACACGTGGTACCTGCAGACGGCACTCTACCTCGTGGCCGCCACGGCCGCCTGGCTGC
TCTTCCGGCGCCTCCTCTACGGTCCGCTCTGGCTGCTCGTCTGGTGGCCAGCTCGCTCCGCCTGGACTGCCTCGGTCGCC
GCCGTCGGGCTCGGCGTCCGTGTCGGCAGCGTCGCCGTCGCACAGGCGCAGGGGCCCGATAGTGGAAGCAGTAGCAGCAG
CAGCATCATCACAAACGCAGTCACCAGTCTGGGCAGTACAGCCGTCGCACATTCGACCCCGGCCGCGGCTACTCCGTCAG
ATTCGCTCGTCGAGCAGGTCGGCCAGATCATCAACGACAGCATCTCACAACAACAGCTACACCAGGAGCAGCAACAACAG
CAACAACAACAACAGCCCGCAGAACCTGCACAACCAAACCCTATGAAGCGCATGTGGGAAGAAGACGTCGAGACGGCCAA
GTACGACGAGCAGAACAAGGACAACCGTCCCAAGGACGAGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62