GenePrediction:GLEAN_4514 Details

Name: GLEAN_4514
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:251100..249996 (- strand)
Length: 1105
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:251100..251011 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_161:250949..249996 (- strand)
Length: 954
>GLEAN_4514 class=GenePrediction position=GCSC_161:251100..249996 (- strand)
ATGTATCGGGCAGCGCCATCGACTGGTGCTGGCGAGTCCATCCGCCAAAAGGCAATGGACGTCAACCGGTCTCTGCGGAA
CATTAAGAATGTATGGGCCCAAAGGTGACGTGCCAGTGCCAGACGACCAGATCCACTGACATGTGTTTCAGGAACTCGAG
ACCCTGCTCGAGAAGGGTGCCATCACTGACGACGCCTTTACCAACATCCACGGCATGCTTCCACAGGAATGGAGTCTGCG
TGACGGACCGCCAGCGAGTGCAGCAGCAGCAACTTCAGCAGCACGTGCCATGTCCCCAGCTGCTGCTCCTGTCGCTGTTG
CCACGCCTCCGCTGCCTGCCCGCCGCACGCCCCAGCCAGCGCCCATCGAGCCGGAACCCGCTCCGATCCCAGATCCGGCC
TCTGATACCGATGCTGACGGCCGCACAGCCATAGGCTATGCCACAGCCAAGTACCGCTACGATGCACCCAACGAGGGCGA
CCTCGGCTTCGAGCGGGGCGAGGCCGTGGCCGTGTACAGCCAGGTCAACGCGGACTGGTGGTTGGGCCGCAACCTGCGTT
CCGGTCAGGTGGGCATCTTCCCGCGACAGTACGTCAAGCCGGATGCGGCACTGGCCGACCTTGAGCGCGCCGGCCGGGTG
CCGTCAGCAGAAGAGGCAGAGGCCACAGCTCGCAACGGCGGGCCGCCCGACTACTACAGCCAGCAGAACCAGAACCAGAA
CCAGAACCAGTACCAGCAGCCGTACTTTGCCGAGAAGACCACCCAGCAGCAGTCTTACGGCCAGCCGCAGCAGTACGGAC
AACAGCCGTATGGCCAGCAGCCATATGGCCAGCCTTCGTATGCTCAGCAGCCTTCGTATGGTCAACCGCAGTATGGCCAG
CAGTCCTACGGCCAGCCTTCGTATAGCCAGCCGCAGTACGAGCAGCACAACCAGCCCAGCCAGCCCAACCAGCCCATGCC
GGCCAACGGCGAGGGCAGTGCTGCACCTCCCGAGGACGACAAGATGAAGAAGACGGGCAAGAAGATCGGTGGCAAGCTGG
GAAATGCCTTTGTGACGGGCGTGGGCTTTGCTGCGGGTGCCGAGTTGGTCAGCGCGATTCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62