GenePrediction:GLEAN_451 Details

Name: GLEAN_451
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1850363..1852172 (+ strand)
Length: 1810
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1850363..1851850 (+ strand)
Length: 1488
Type: CDS
Source: GLEAN
Position: GCSC_167:1851916..1851948 (+ strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_167:1852035..1852172 (+ strand)
Length: 138
>GLEAN_451 class=GenePrediction position=GCSC_167:1850363..1852172 (+ strand)
ATGGATCCAGGACGAGCAGCAATGATTTCGGGCACGAAGTCGCCGACTGGGAGAGACAGAGACATCACGGCCCCTCGACG
GGACACAAACAACCGGATAACAAAGCCGTCTTGGGAGAGGCGGCCGCCAAATACGACGTCGACTGCAGGCACGACAACAC
GAAATGCAAAGAGCGGCGGAGGCGGCGGAAACAACTATATGACAGAGGAGCAGCTGTCGGAGAAGTTTGTGGCCGAGGAG
GACAAGTTTGTGCTGCGGCAGTCGAAGAAAAAGGCGGACATTCGGGTGCGGGAGCGACGAGCGAAGCCGATCGATTTTCT
GGCATTCCACCTGCGGTTTGTAGACTCGGACCGCGACGTGTTTGACGACGAGCCGACGGATGTGGAGACGGACGTGCCGG
GGCCAGAGGCGGTGCTGGAGAGCGCGAACGCGGAGCAGCTGGCCGAGCTGGAGGCGGACATCCGGTCGTTCCACACGTTG
GAGCAGAACGGGGCGAACCGGGCGTACTGGCAGGCGATGCTGGTGCTCTGCCGGGAGCAGCGCGAGCTGGTGGGCGGGCC
GCAAGGGGGGGAGGCGCGGCTGCTGAGCACGGTGGCGGGCGACATTGACCGGATTCTGCGGCCGAAGGCGCTGGTGCAGC
TAGAGGCGCTGGAGGCGAGCATCCGGGCGAAGCTGCGGTCGGACGAGGCCATCGACACGGACTACTGGGAGCAGCTGCTG
CGGCGGCTGCAAGTCTGGAAGGCGCGGGCGGCCGTGAAGAAGACGGGCGCGGCGGTGCGGACAGCACGGGCGACGTTGCT
GCGGGAGCGCGACCCAGCCAAGGCGGAGGCGGTGGAGAAGGGACTGCCGGTGGCCTCGGCCGGCGAGACAGTGCGGAGCG
AAGAGGAGACGGTGGCAGCAGACGACGACATGGCCGGCGGCATCGGCGCCGGGCTGGACGACGACGAAAACGAAAACGGG
ACGGCCGCGCCGCCGGGAACAGCCCGGTTTGCGGCCGTCAGCGGCGAGGATTTCTCGCAGGCAACCAAGGCGCTGTACGA
CCGCGAGGTGGCGCGCGGGGTGCGCGAGAACGAGGAGATCTTTGCGGCCGAGGAGGTGGTACCGTCGGCCGGCAAGCCCA
AGTGGGCGGACAAGTACCGACCGCGCAAGCCGCGATACTTCAACCGGGTGCAGATGGGGTACGAGTGGAACAAGTACAAC
CAGACGCACTACGACCACGACAACCCGCCGCCCAAGGTGGTGCAGGGCTACAAGTTCAACATCTTCTACCCAGAGCTGAT
CGACAAGACCAAGGCGCCGACGTACCACATCATCCGCGAGGGTGGCCGGCGGCGAGGCGAATCGTTTGCGCCGGCCGGCG
AGGAGGACACCTGCCTGATCCGCTTCTCGGCCGGACCGCCGTACGACGACATCGCCTTCCGCATCGTCGACCGCGAGTGG
GACTACAGCGCGAAGCGGGAGCGGGGGTTCAAGAGCAGCTTTGAAAAGGTAGGCTTGGATTGGACTCGGGCGTGTCGGCC
AAGTGTTGCGTGTGCTAACGATCTCAACCACAGGGCATCCTGCAACTGCATTTCCAGTTCAAAAAGGTAAGCACTCGGTC
GAGACGGTGGCGGATGGCTTGTTTCATTGTACACGTTGCTAACAGACGCCTCAGATTTACTACCGGAAGTAGATATGGGA
TGGAGGGAAGCGAGAACTGCATACCGATTCTGGACTGACCACAACTCCGGCAAACGGAACGGCCAGGCAGGGTCATAACG
GCGCCGAGACGTGTGATAGCAGGACGAAAATCGCCATGGAAGAGGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62