GenePrediction:GLEAN_4521 Details

Name: GLEAN_4521
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:174078..172802 (- strand)
Length: 1277
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:174078..174023 (- strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_161:173964..173458 (- strand)
Length: 507
Type: CDS
Source: GLEAN
Position: GCSC_161:173400..172980 (- strand)
Length: 421
Type: CDS
Source: GLEAN
Position: GCSC_161:172840..172802 (- strand)
Length: 39
>GLEAN_4521 class=GenePrediction position=GCSC_161:174078..172802 (- strand)
ATGGAGAAACAGCCACCAGAAACGAAAGCACATTACTGGAGCGGCGACAATGCTAGGTAGGCTGCAGATCTTAGGTCTAC
CTGCCTAACGGAAACAAGACTGACGCCAGTTTAGCGCTCGTGATTCGGGCACAAGCAGTCCTCTCGATCCCGACAATGTC
TCGACAGATAGCCACGAGAAGCCGTCGAGTTCTTCACATACAGACAACTCGGCAGAGTTCGGCGCATACTTCCCTCCCGA
AATCGCACAGGTGGCACACTGGAGGGAACACATCGGCCTATCGGATTTCGCCATCATGCTACAACAGTCTCTGAAAGGCG
CCTTTCCCAAAGACAACGCCTCTCAGTACACCAAAGCTTTCGTTCTTCTTGTATATTGGGAGGTCGGAGTCCCGTCTCTA
CCCATTGAGCCCGAAATAATCCGCCTGAGAGACGCATTTACTGATGTGTTCAACTTTGAAGTTGAAATGTTCCAGATTCC
CACGTCTCGCAGCCACATCATGCTTAGCCGGAAGATCAACGATTTTGTCTTTCTGAATGACGACAGCAAAGACGATCTGA
AAATATTTTACTATGGCGGGCATGGAAAACTCACAAAATCCAGAGAGCTACTGTTCTCAAAGTACGGTCTGCCCATCCCC
ACATTCGTCCCCTGGCCTTTCGACTAACCCAAGACTAGCAACCTAGGACATTTTGGACTCAAGGAAGAGACCCTTACGTG
GAGCGGTATTCAGTCGACGCTTGAGAAGGCTCTCAGTGACGTCCTAATCCTACTTGACTGTGGCGAGTCTGGTATGGTCC
GCTTTGGCGAAGGCCACGGAGTGACTGAGCTCGTTGCTTCTTGCAGCTACGACGCCAAGACTAGTGGTTTTGGCGAAGCT
TCCTTCACTAAAGCATTGGTCACCGAGCTCAAGTCTCTCGCAATTAGCAAACTTCGCTTCACAGCCTCCGACCTATGGGC
ACATATCTACAACCGCATGCAGTGCCATATCCCTACAGGACATTCTAACGATAGATATCCTGCCCCGGTCCATTTCTTCA
TCACTAGAGATTCAGATTTCGACAGGTCTATAGATTTGACGCCTTTGCCTCCCACTCCGGTTGGAAAAAAAAAAGCAGTC
CCAAGCTACGGATATCCGACTCCAGGGCAAGGTATACAACCAAAAAATCCTACATAGCTATAGCGACCACTACGAGATTT
GGCGCATGCTTACCTGAAACAGTTCTTTATAACCGCAGATTAACCGCAACCTCCTGGCCGAGATGAAATTTGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62