GenePrediction:GLEAN_4522 Details

Name: GLEAN_4522
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:161524..159768 (- strand)
Length: 1757
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:161524..161083 (- strand)
Length: 442
Type: CDS
Source: GLEAN
Position: GCSC_161:161026..160948 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_161:160894..160576 (- strand)
Length: 319
Type: CDS
Source: GLEAN
Position: GCSC_161:160498..160285 (- strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_161:160222..159917 (- strand)
Length: 306
Type: CDS
Source: GLEAN
Position: GCSC_161:159853..159768 (- strand)
Length: 86
>GLEAN_4522 class=GenePrediction position=GCSC_161:161524..159768 (- strand)
ATGAGGCTTTTTACGCTACTTGGCTGTCTACCGTTCCTGGGTCTGGCAACTGCCCAGCTGATCGGCCCTGTGGGTCCTAC
AACGCCACTACACGAGAAGAGGCGGATATGCAATGTGCTGGACTTTGGCGCTGTCCCGGACAACTCCACTGATGTGGCTG
ATGCCCTCGAGTCTGCCTTTAACTACTGCGTGCTTCGGCATCCGGGCAGCCGTCTGGTGATCCCGGAAGGGTCGTACCTT
TTGAACCGGTCTGTTGTCCTCAGCAACGCAACAAACTGGGCTTTCCAAGTTGATGGGCTCATCAGTCTCGGATACGGAGG
AAATTACACAGTTGCACGTGAGTTGGTCCTGCAGGGCTATGTTGGAGCAGACGTGCTAAACAGCACCATCAACGGCGAGG
GTGACGGTCACTTCTTGATAGACGCTCTGGTCATTGTCAATCGTGAGTTTGTCGCCACGCTTCTGCTTCGTTTCCAGGGA
GCTGACATGGTATTGCAGCGGTCGACTTTGAGTTTTACTCCGAAACAGGAAGAGGCGCTTTCCAGGGACAAGGCTATCTC
TGGCGCAATGCGAACAAGTAAGACTATCCTTTGTCGTAAGATGGTATGTGTACAGCTGATATTTGTCTAGCACTGATCGC
CCACGCCTGATCCGCTTGGTCTCGCCCATCAATGCCGTCGTGCACGACCTGATCTTGGTGGACAGCCCCAAGTTCCACAT
TGTGCTTGACTTTGTCGAGAATGTCGAGGTCTACCACATCACCGTGCGTGGCGCTAATCTGGGCTCATACGACGGTGTCG
ACATCATCGGCACCAACTACTGGGTCCACGACATCGAGGTCACCAACCGGGACGAGTGTGTCTCGGTTAAGAGCCCGCCT
AATCATGGCCTGGCAGAGGACTTGGTTTACAACCAGGCTGGCTCCGGCGTCTCCATTGGCAGTCTGAATGTGTCTGCATC
TATTGCAAATATTGTCGGTACCCTGCCGTCGTCCTACTTGGTGCTTAGAACTGACACTCTGTGCAGCACGCACGGAACAT
TAGCATTATCGGGGGAAACAACATCGCCTTTATCAAGACCTACCCAGGCGGTTCCGGCTACGTGACCAACATAACCTTTG
AGAATTTCCGTTCCAAAGCGTCTCAGTACGGCCTCAACATCAACCAGTACTGGCAGAACAAGAACGAACCCGATACCGGC
TCGGTGGCCCTGAGCAACCTCATCTTCAGAAACTTTTCCGGTAGGCATCGAGAGCGGACGTGAGAATTGGACGAACGGAC
GGAAGCTAAACGTTTGCGACAGGTTCTGTGGTCAATGGCGTCAGGAGACCCCCTCTTTACCTAGTGGCCAATGATCTGAC
CTTTGCTCGGAATGTGACCGTTGAGGACATCTCCATCTGGACCGAGGCCAACGGCTACGTCGTGAACACGATTTCAAAAG
TCTTTGGCCAGGGCGACGACTCGTACAGCCCCAACGACGGTCTGAAGACACTTGGCGTTGGTGAGACACCGACGCCATAT
ACCACCGCCATTACCGTGACGGCGACCCCTACGGGCTGGACGTTGCCTCCTTCGCCAACCTGGGCAGTTCCTGACACGGG
CTACGGCAGTACGTATCGTCCTTCTTTTCCCCTCTGTTCGCACCGATCAACTGACTCGGTCTCGTGGCCAGCCAACATCC
CAATTCCTGTATACGAGCCAACTCCACTATGGAGGCCCTATGGAGATTACAGCTTGCATTATTGGGGCACTTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62