GenePrediction:GLEAN_4523 Details

Name: GLEAN_4523
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:158403..157509 (- strand)
Length: 895
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:158403..158154 (- strand)
Length: 250
Type: CDS
Source: GLEAN
Position: GCSC_161:158107..157509 (- strand)
Length: 599
>GLEAN_4523 class=GenePrediction position=GCSC_161:158403..157509 (- strand)
ATGGCTGCTTCTACACGCACAGCACAGCTCATCGCCCTTGTTGGCAGGAGCTCCTCTCCGAGGGTGGGCGCCACCGTCTT
GTCTTCGCCTGCACGCCGCCTCTTCCCCGCCGTCCAACATCGGTCCTTTGCCTCATCGCCGGCCCGCGCCGGCCAGCTCG
ACGGGAAGCGCATTATCGTAACAGTCGGTGCCATGGGCATTGGCGAGTCGGTGGTGCGCGCATATGCGGCCGAGGGTGCC
CGCGTTTGGTGTCCATGGATGTCAAGCACAAGCTAGGCCACCGGGTGGCTGAGGAGGTGACGGCCACGGGGCCTGGGTCG
GTCGCCTGTCTGCCTGTCGACGTGTCGTCCAAGGTGTCGGTGGCCTCGACGTCATGGTCAACGTGGCCGGCATCCAGAAG
CACGCTGTGCCCGAAGACGTATCCGAGGAGCTGGTCGAGGCCATCATGAAGGTCAACCTCTTTGGCACCCTCTACACAAG
TTCTGTCGCCTACCACCTCTTCAAGAAGTACGGCGGCGGCGGTGTCATCCTCAACTTTGGCTCCTACGAGGGCCTTACCG
CCGGCCACCACAACGCCATCTACGGCGCCACCAAGGGCGGCGTCCACACGTGGACTCGCAGCGTCGCGCGTGAATGGGGC
CCTGCCGGCGTGCGTGTTAATGCCGTTCTGCCCTACGTCGCCACCCCTATGTACGACGATTTCATCGGCGCCATGTCGCC
CGAGCAGCTCGCTGCCCACAAGCGCGAGCTCAAGGAACAGTTCCCTCTCGGTGGCAACCTCGGCGACCCGCTCAAGGATC
TAGGCCCCGTTATGGTCTTCCTCGCTAGCGATGCCTCGCACTGGATGACCGGCCAGTTGTTCCCTGTCGACGGAGGGTAC
GTTGCAGTTCGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62