GenePrediction:GLEAN_4524 Details

Name: GLEAN_4524
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:153780..152430 (- strand)
Length: 1351
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:153780..153509 (- strand)
Length: 272
Type: CDS
Source: GLEAN
Position: GCSC_161:153438..153331 (- strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_161:153266..153015 (- strand)
Length: 252
Type: CDS
Source: GLEAN
Position: GCSC_161:152920..152728 (- strand)
Length: 193
Type: CDS
Source: GLEAN
Position: GCSC_161:152672..152430 (- strand)
Length: 243
>GLEAN_4524 class=GenePrediction position=GCSC_161:153780..152430 (- strand)
ATGGACCGGAGGAGGGCCAGCGACGGGAGGGACCGCCAAGGAAAACTGCTCACTCTGCACACGTCAGCGCTATTTGACCC
AAAATACGGCGGATTTCGCGAGAATATTTCCGTGGTAGTGGATGCGGAGAGCGGATTGATTGTTGAGGTATACGAGCGCG
ACGGAGACGACACTCTGCAGTGGCTTGGAGAGGGCGACATCGATCTACGTGGCTTATACGTGCTTCCCGGTCTCGTGGAT
GCACATACGCACATCTTTCTGCATTCATACGAGTGAGCAGCCGTACCGGTGAAGGCCAGAGGCCCCGCGACAACGAGGCA
TGTCGAGGCTGACAGCAAACAGAGAGGCCGATGCACTGCACCAAAAGCGAGATGAGAGCATAACCGAACGCGTGGTGCGT
GGCGTGAACCACTGCCGGGCAGCTCTGCTTGCCGGCTACACGACATACAGGTGCCCAGAGATCGATGTTGCCGCGCTTTT
ACGGGCAGAGCTGACACTTTCTTCTGATCCACAGGGACCTAGGCTCGGAAGGCATGCAGGACGCCGACACCAATCTACGG
GATGTCATTGCACGCGGGCTCATGCCAGGGCCACGTCTCTTTGTGGCCACGCGCGAGCTGGCCAGCACAGGCTCGTTTGA
GCTACGCACAGAGAACGCAGGTGGTGGCCATCACGTGCCGCCAGGCCCGGACGTAGCCGATGGCGTGGAGCAGTGCCGAC
AGGCCGTGCGGCGGCGCATAGCCGCAGGTGCTGATGTGGTGAAGGTGTATGTGGACTACCGACGGCGGGCGATGCGTTAT
CCGGGCGGCCAGGTATATCCACCACGGAGTCTGAACCCAGAGTGCGTCGTGTTCACGCAGGCCGAGGTTGACACGATCGT
GGCCGAGGCCCGGGATGGCCCAGTGTCCTGTGGCTGCACACTGCGGCACTCGAGACGGTGCCCTGATAGCCATAACTGCC
GGCGTCACGTCGATCGAGCACGGGACTGCCATCACCGATGACATGCTGCCAACCATGGCGGCCGAAGGCATCATATTCGT
GCCGACGCTGGCCGTATACGAGAAGATGCGTCCCCCAGCTTCTGCCGATGCTGCAAGAGCGCGTGAAGAACGCATATGAT
GCGGGCGTGCGGCTCGCCTGTGGTGGCGACACCGGCACATTTTCCCACGGCGACAACGTGCGCGAGCTCGAGCTCATGAT
CGAGGCCGGCGTGCCCGTGGCCGACGTCATCGAGTCCTGCACTGTCGGTGGCTGGGAGGCCTGTGGTGGCGAACTCTGTG
GGCGGCGCTTCGGCTGGTTCGAGGCTGGCCTGCAGGCAGACATCAGCGCCCTGGACGGTGATCCAGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62