GenePrediction:GLEAN_452 Details

Name: GLEAN_452
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1852611..1854143 (+ strand)
Length: 1533
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1852611..1852923 (+ strand)
Length: 313
Type: CDS
Source: GLEAN
Position: GCSC_167:1852993..1853118 (+ strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_167:1853197..1853496 (+ strand)
Length: 300
Type: CDS
Source: GLEAN
Position: GCSC_167:1853560..1854143 (+ strand)
Length: 584
>GLEAN_452 class=GenePrediction position=GCSC_167:1852611..1854143 (+ strand)
ATGAGACCGCTCTCGCTGCTCTTTGTTTTCGTATCGGCTGTTGCGTCCGGCAGCACTCGTCCGCCGTGTCTGAGTCGACG
GCCGGCCGTGGTGCCGCGTCCTGCACATCCACGGCTGCCCGTGCCTCAGCCGCCGAAGCGATCGCGCGTGTGCGAGGTGC
AGACGCACGGCGACGGCCAGACGGACGACTCGACACTCATCCTCGAGGCCCTGCACGCCTGCAACAATGGCGGTCACGTG
CTGTTTGGCCGGGACGCCACCTTTGTCGTGGGCACGGCCCTGGACCTGACCTTTCTGCAGCATGTCGACATTGGTGAGGA
GATGGATCCAACGCCCACCTGCTGACTGCTGAGCTGACAGCTCATTGCTGACTGCTGGCCAGACATCCAGGGCCGCATCC
TCTTCTCCAACGACACGGATTACTGGCAGGCCAACTCGTTCCGCTTCGGCTTCCAGAACGTCACCTCCTTCTTCAAGCTC
GGCGGTAAGGACGTCTTCCTGTATGGTGGTACGTCGTTTCTCTTCCTCTTTGTCTCTGCCTTTCCCTCTCTCTCTCTCTC
CTCTCCTTCTCGTGGTAACCCTTCAGGTGGCACCCTTGACGGCAACGGCCAGGCCTGGTATGACCTCTATGCCGCCGACA
TCTACACGCTTCGGCCCGTCTTGGTGGGCATCGACGGACTGCACGACAGCGTGATTGCAGACCTGCAGCTGCGGTATAGC
CCAATGTACTATAGCTTTGTGGCCAATGCGAGCAACGTCGTCTTTGACCACATCAGCATCGCCGGCGCCTCGACCAGCAA
ACACGTGGCCAAGAACACTGACGGCTGGGACACGTATCGAAGCCGAGACGTGACCATTATGAACTCTGTCATTGACAATG
GAGATGGTGTGCTTTTTTTCTCCTCTTTTTCTCCTCTTCCTCCCTCTCTCTCCCATCCTAACTTCCCAGACTGCGTCTCC
TTCAAGCCCAACAGCACCGACATGCTGGTCCAATCGCTCGTCTGCACCGGCAGCCATGGCATCTCTGTCGGCAGCCTAAG
CCAGTATCCCGGCACCTTGGACATTGTCGAGCACATCCACGTGGCCAACGTCAGCCTGCACAATGCCACCAACGGCGCCC
GCATCAAAGTCTGGCCCAACGCGCCCACCGTCCTCGCGGACGATCTTCAGGGCGGCGGTGGCAGCGGTCGCGTCAACAAT
GTCACGTACACCGACATTGACGTCGCCAACGTCGATGACGCCATCGAGATCACCCAGTGCTACGGCCAGAAGAACCTGAT
GCTTTGTGTCAGCTTTCCGTCTGCCCTGACCATCAGCAACGTGCGCTTCCGCCGCTTTACCGGCACTACGTCCGCCACGT
ATGCGCCCGAGATCGCCGCCTTTGCCTGCTCCTCCACCGCCGTCTGTGGCAACATCTCTGCCGTCGACATCGCCGTTACC
AGTCCCCAGGGCAGCCGCCAGGCCTACTGCCTCAACCAGGACACCACCACCCTCGATGTCGACTGCACGGACGTTTGGAA
GGGCTTCAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62