GenePrediction:GLEAN_454 Details

Name: GLEAN_454
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1874334..1876328 (+ strand)
Length: 1995
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1874334..1874708 (+ strand)
Length: 375
Type: CDS
Source: GLEAN
Position: GCSC_167:1874808..1876328 (+ strand)
Length: 1521
>GLEAN_454 class=GenePrediction position=GCSC_167:1874334..1876328 (+ strand)
ATGGCGCACCAAGGCCCCTCATTTCTCCTGCCGCAGAACCGGAAGCTCCGCCATCTGCGCGGCGTCTCGCTTCGCAACCT
GACCTTTGCGCGGCCGCGTGGCCGCACGATTGACGACAGCAGCATCCAACGCTCCTCCGACACGCGCGAGCCCCTGCGCT
TTCCCCCCTCCCTCGCCCATGCCCACTCCAGCGACGACATCCGGGTGGATCGCGCCCGCGGCCGTCGCGTCACCCTGTCC
GGCACCAGTGCCAATGCCCGCCAGCGCATCCTCGAACAGGCCCTCGAGCCCAACACGGCCGATGCCTTTTTTTCCCTGCA
CCACCACGCCGCTGTCGAGCCGATCTACGTCAGCGAGGTCGAGGACAATGCCACGGTACGACGCTGTCCGCCAGAGCGAG
CCCGCACCACCTTCTCACCCTTCCTCTTTCATGCCGCGCGGCTGGCCTTTTCCCTCATGCTGACTAATCACTAGAACTTC
AACTTCCGTCTCTTTGATCTGACCGACGTCGACCCGCACGTCTCGCGCGGTGCGCGGCTGGTCGTCAAGGTCTGGGTCCG
CCGCGCCGGCGTCTGGTACTTGCTGATTGAAGACCACGTCGACCTACGCTGCCTCGGCTGCATCGGCCCATCGCTGCAGG
GCAAGAGCCGCGGCCCCGGTGCGGCGACCAGCAGCACGGCCGGCACGGCCATGCACTTCCCGCCCAACAGCATCGTTTTC
CATCTGGTCGACGGGATCTACATGTTTGGCGTGGGTGCCGACGGCGATGCATCGTCACCGCTGCCACCACCGTCGAGGAA
GCAGGCACCCCCGCTCTCGACGGCCTCCTACACGGCCCTGATGCGGCTCGCCAACCTGGAGAACTCGCTGCAAGACGCGC
TCGCATCCCAGGTCCGTCTGGCCGTTCAGATCGACGACCTGCTGCGACAGCTCAGTGACGCCGAGACCACCGCAGCGACG
GCCGTGCCCGACGCCGAAGCACGCACCCGTCGGGTCCTCCGAGGCGCTGCCCACCAGCGGCGTGGCGCCGAGCTGGCTCG
CCAGAAGCGTGATGACATCGGCCGGTCGTTGCGGGCGCGTCGTGCTGCCATCGCCGCCGGCCGGGCGCTGCAGCAGACCG
CGCTGGACGACATTGAGCATGCAGCCCGCAAACTGGCTGTGTCACGTGAGACGGCCTTGCAGACGGCCGACGACATCCGC
GGCCAGCGGCGTCGCGTGTGCGAAGATCTGATGCGTATCTTCGCCATCGAGCCGATACCACCACCGCCGGACGGCCAGCA
GCAGCTGCCACCGCCGCTGTCGTTCCAGATCTGCGGCATGGCGCTGCCCAACACCGATTACGGCCCGGCACTGCTCTCGG
GCAGCAGCGCGGGCGGCTTCGTGGCCGAGGAGGTGCTCTCGGCGGCTCTCGGCTTCGTTGCCGTGCTGGCCCATGCGCTG
CAGACGTACCTCGGCGTCGTGCTGCCATACCGCATCACGCCCTACGGATCGCGCTCGGCCATCCGGGACGACATCAGCAA
GATCCCCGACCAGCAGCGCGACTTTCCCCTACACATGCCACGAGGCGGCCTCGGCGCCCAGTACCGCTTTGACTACGCCT
GGTTCCTCCTCAACAAGGACATCGAGACGCTCTGCAGCGCCCAGGGCATCCGCGTCGTCGACATCCGCCACACCTTGCCA
AACCTCAAATATCTCCTCTACGTCTGCAGTTCCGGCTCCAAGGAACTGCCCCAGCGCAAAAAAGGCGGCGTCCGTGGTTT
GCGGGCATTACAAAAGGCCGCTACCGATGATAGCATCCCTAGGAATCTGGCGGTTTCCGCAGAAGGAAAACAGCAACAGC
AGCAGCTACCACAGGGCTGGGACGCCAGCAGCAACGGCAAGACTGCAGCTTCGCTGGCGCAGGCAGTCAGCCTGAACCTG
CCGTTTTCCGACGACGGCGCAGTGCTCACGCTGCGGACAAAAGGCATGCGCGAAAACGTGGACGGCCGATTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62