GenePrediction:GLEAN_4555 Details

Name: GLEAN_4555
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1954741..1953820 (- strand)
Length: 922
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1954741..1953944 (- strand)
Length: 798
Type: CDS
Source: GLEAN
Position: GCSC_167:1953891..1953820 (- strand)
Length: 72
>GLEAN_4555 class=GenePrediction position=GCSC_167:1954741..1953820 (- strand)
ATGGCCCCCTCTGCAACGTCGACGGCCACGGTGACGGCAGCCCAGCAGCCCAAGATGTCGCTGGCGACCGAGGATGAGGC
GCTGGCGGCCATGGCCCACCGCGGCAAAGCGCTGCCGGGCATCCCGGTGTTCGCGACGCACGCAGAGACGCGGCAGTGGC
AGCTAGAGCACATGGCCGCGGCCTTCCGCGTCTTTGCGCGCGAGGGATACAGCGAGGGCATCTCGGGTCACATCAGCGTG
CGCGACCCCGAGCACGCGGACCGGTTCTGGATCAACCCGCTGGGCGTGCACTTTGGCATGATGCGAGCGAGTGACATGAT
CTGCGTCGATCTGGCCGGTGAAGTCGTCGGCGGCAACACGGCCGGCTCCATCAACGCGGCCGGCTTCTCCATCCACTCGT
CCGTCCACCGGGCTCGGCCAGACATCCACGCCATCTGCCACACGCACTCCGTTCACGGGCGTGCCTATTCGGCCTTTGGC
CGTCCGCTCGAGATGATCAACCAGGACGTCTGCTACTTTTACCGTGCCCACGCCGTCTACTCGCAGTACGGCGGCATCGC
CAACGACGCGTCCGAGGGTGAACGTATCGCTCAGAGCCTCGGCGCCCACAACAAGGCCGCCATCCTGCTCAACCACGGCC
TCCTCACCACCGGTCGCACCGTCGACGAGGCGGCCTTCCTCTTCTGCCTCATGGAGCGCAGCTGCCGCGTCCAGATGCTC
GCCGACGCCGCTGGCCTGCCCAAGACCATCGTCAGCGACGACGAGGCCGCCTACAACTTCCGCATGGCCAGCACGCCCGT
AAGCACGCTCGTCTGCTCCTGCCCTCCCTGCTCCCATGCTAACGTCCCAGGACTGCCTCTATGTCGAGTTCCAGCCCGAG
TACAAGTACGAGGAGTTCCGGTCCGACGACTTCAAGCGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62