GenePrediction:GLEAN_4556 Details

Name: GLEAN_4556
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1953269..1951345 (- strand)
Length: 1925
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1953269..1953113 (- strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_167:1952958..1952388 (- strand)
Length: 571
Type: CDS
Source: GLEAN
Position: GCSC_167:1952320..1952108 (- strand)
Length: 213
Type: CDS
Source: GLEAN
Position: GCSC_167:1952050..1951345 (- strand)
Length: 706
>GLEAN_4556 class=GenePrediction position=GCSC_167:1953269..1951345 (- strand)
ATGGGAATACCTAGTGTCGACGAAAAGGTGGCAACTGCCGACAGCGATGTGGCCGAGGGCCAGGCTACCAATGTCTCGGC
CGGTTCCCAGCACCTGCACCGCAAGCTACGCGGTAACGAGGTGCAGATGTTTGCAATTGGAGCAGCCATTGGAACGTGTA
CGTAGTACTGTCAATCTCGCTGTGCTTTCGCGTCTGTTGAATTTTGTTGGATATATCATTGTTTTGTTTGATTCTTGAAT
ATCTTGATTTTCCTCTCCTTTTCCGTTGTTTACATCGTTCTATGGTCTCCTTCTTCCGCTAACCCCCCCAGCCCTGTACG
TGCAGATGGGCTCTGCCCTGCCCAAGGGTGGCCCTGCCGGCCTCTTCATCGCCTTTATCATCTGGGGTGCCATCATGTGG
GCCGTCAACGAGTGCTTCGCCGAGATGGTCACCTACGTTCCCGTGCCGTCCCCCTTTGTCCGCTTCGGCAGCGAGTGGGT
CGACGGTGCGCTCGGCTTCGCCATGGCCTGGAACTTCTTCCTCAACATGGCCTTTCTCGTGCCCTTTGAGATCGTCGCCA
TGAACATCATGATCACCTTCTGGTCCGACGATGTGCCTGTCTCGGCCATCATCATGGCCATGATCGTTGCCTACACCCTG
CTCAATGTCGCCACCGTCCGCTACTTTGGCATCAGCGAGTTCTACCTCTCCATCTTCAAGGTCCTCCTTATGCTAGGCCT
GTTCTTCTTCACCTTCATCACCATGCTCGGCGGCAACCCAATCCACGACCGCTACGGCTTCCGCTACTGGAAAAACCCGG
GCTCTTTTGTCGAGCACATCGTCACCGGCAACACCGGTCGCTTTTGCGGTATCATCTCCTGCATGTACCAGGCCAGCTTC
TCGTACGTCTCTCCCTCTCCCTCTCCCTCTGCTACCGGCTCCTGCCACCCCGATTCTGACACGATCCAGCGTCTGCGGTC
CCGAGTACATCTCCATGGTTGCCGGCGAGGCTGAGAACCCCCGCAAGGCCTTGCCGCCTGCCTTCCGCTCCTTCGTCTGG
CGCATCCTCTTCTTCTTTGTCGGCTCGGCACTTTGCATGGGCATCGTCATCCCCTACAACGACACCACCCTGAGCAACAT
CCTCGGCGGCACCACCAGTGGCTCCGGAACCGGTGCAGCATCGTGAGTCCATCTGCCGCTCCTGATTGTCTCTCTATAAA
GACTAATACACATTTGCAGCCCCTATGTTATCGCCATGGAGCGCCTGAAAATCAGCGGCTTGCCCCATCTCGTCAACGCC
CTCATCATGACCTCCATCTTCAGTGCCGGCAATGGTCTGCTCTTTTCTGCCACCCGCACTCTGCATGGAATGTCGCTCGA
GGGCCACGCCCCTCGCTTCTTTTCCTTCTGCACAAAGGCCGGCGTCCCCATCTACGCCCTCCTCTTCTCCCTGTGCTTCT
GCTTCCTCGCTTTCCTGCAAGTTAGCAGCTCCTCGGCCGAGGTCCTCAACTACCTCGTCGACCTTGTCACCTGCTGCCAG
CTGATCAACTACCTCTGCGCCGCTGCCATCTACCGCCACTTCTACTCCGCCCTGGCCCGCAATAACATCTCGCGCGATAC
GCTGCCCTACAAGGGCCGCTTCCAGCCGTACACGTCCTACATCGCCATGGCTGGCACCACATTTATGCTTCTTGCCGGTG
GCTATGATGTCTTCATCTCTGGCCGCTGGTCTATCAAGTGGTTCATGCTGGACTACGCCATGATTGGCTTTTTCATCGTC
CTATTTATTGTCTGGAAGCTCGTCTTCCGTACCTCTTATGTGCGGCCAGGTACGGCAGATATCAGCCTCGGTGGTCTGAA
AGAAGAGATTGACAACTACGAGGCTATGTACGTTGCTCGGCAGCGTGGCAAGATTGGAAAGTATATCGATAAACTGTTCG
AATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62