GenePrediction:GLEAN_4557 Details

Name: GLEAN_4557
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1950178..1949034 (- strand)
Length: 1145
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1950178..1949921 (- strand)
Length: 258
Type: CDS
Source: GLEAN
Position: GCSC_167:1949854..1949120 (- strand)
Length: 735
Type: CDS
Source: GLEAN
Position: GCSC_167:1949057..1949034 (- strand)
Length: 24
>GLEAN_4557 class=GenePrediction position=GCSC_167:1950178..1949034 (- strand)
ATGTCGTCGGACCGTTCCATTTCAGAGGCGGCACAGAACCAAGTCCGGAGGTTTTGTCGCCAGTACTTGCAGCTTGAACA
GCAGCTGACATATCCCGACGCGCAGTACTTGAAAGAAGACAGTGTTCAGGAAATTATCTATCAGAGTCTCTGGGGACCAG
AAGCACGGCACAATTGTGGCTCACCTCGGTACCAACTCAAAACTCTTAAAAAACTTGTCGGGAACGTTGAAGCCGGCATC
GAAGACTGGGATAAATACGTTAGTACGCCATAGTTGCAATTAACTGAGAGACTACGGGCTTCACTCTACTAACATGATAT
GAAGGGGGTTCATGATGGCCTGATGGAGCGCATGTCGGAACTGCTCAGCCAGCCACTGCCCTCTGAATTGGCAGCCGCCC
AGCAAAAAACTTACGTTGTATACACCATTTCTGCACTCGATGAGAGCGGTGGTAGAGATATTACTAAGGCGTCCGACGAT
TGCCCAAAAATAACGCTTCTTGAATCCCGCACGATCATTTCCGCGCAAGGGACGACTGGACTGGCGACATGGGAGGCTGC
ACTTCACATGGGTCAATACCTATGCAGTCGACCTGATTATATAAAAGGAAAGCACGTCCTGGAGCTTGGGGCAGGGACAG
GTTATTTGTCTATCCTGTGCGCTCAGTATTTGGGAGCTGCGGATGTGCTCGCGACTGACGGATCCGATGACGTCATCAAT
AACCTACCCGAGAGCTTCTTTCTGAACGGCCTGCAGGGCTCGACGAAGGCCACGGTAGCGGGCCTTAAATGGGGCCACGC
ACTTATCGGGACGGAAGAGTCGAAGTGGAGAGGAGGACGGCCGGTGGACATCGTGTTAGGGGCTGATATCACCTACGACG
GCAGTGTCATACCTCTCCTCATAGCAACATTTACAGACTTGGTTGACCTGTTTCCTCATGTTGTCATATTGGTGGCGGCC
ACGGAGCGTAACAGAACAACCTTCGAGAAATTTATGACCTCGGCATCGCGGTCTGGCTTCACGGTGGAAGAGATCACTTT
CCCTTTGACACCAAGAGAGGTACAAGCAGGTCCTTTTTACAGCGATTCTGTGCCCATACACATATGTTTGCTACAGTACA
GAACGAAGATAAATACATAGTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62