GenePrediction:GLEAN_455 Details

Name: GLEAN_455
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1878087..1879700 (+ strand)
Length: 1614
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1878087..1879004 (+ strand)
Length: 918
Type: CDS
Source: GLEAN
Position: GCSC_167:1879062..1879700 (+ strand)
Length: 639
>GLEAN_455 class=GenePrediction position=GCSC_167:1878087..1879700 (+ strand)
ATGTTTCTGCGAGCCGCATCCCGCGGCCTGCGGGTGCCAGTCCTAGCACCAGGCATGCTCCGATCTGCGATTGCCCAGCC
GAGACCAACGACGGGTTCGATTTCGGCACGGATTCCAGCACGATGCCAGTATTCGACGCGGCCAGACAAGCCAAACAAGC
CAGCAGGCCGGCCTGACTCCAGAAAAAATAAGCCGGCCGCTGAAGCGCCCAAGGAAGACGTCCCGGGCCCGGTCGAAGAG
GAGATTCCACTGTCGTCTCTGCCCGACCTGACGCAGGGCATCCCGTCGACGCTGGCACAGGAGACGGCCGGGGTGACCGA
CAAGGCGGCACTGGCAGTTCTGGAGCAGACGGCGTCTGCGGGAGGCCGCGGAAAGGGCGAGCTGCCGGCGTCGGCGTATG
TGTCGTCATCGGAGCGGCGGCGTCAGAAGGTGGCCAACTACCTGTTTGCCGGTGCATTTGGGCTGGCCATGGCCGGCACG
GCGTACCTGGGCCGCGACTGGGACGAGGAGGAGGGCAAGAGACACACAGAGGTGCCCAACGGCTGGGGCGTGGGCCTCTG
GTGGAAGCGGGCATCGGCGCGGATGGGCGAGCTGCTGTCGTACTACCACGAGCCGGCATTTGAGAAGCTGCTGCCGGACC
CGGATCCGATCTATGGGCGGCCGTACACGCTCTGCATCAGCCTGGAGGATATGCTGGTGCACAGTGAGTGGACGCGCGAG
CACGGCTGGCGCATCGCCAAGCGGCCGGGCGCCGACTATTTTCTGCACTACCTGAGCCAGTACTACGAGCTGGTCCTCTT
CACGACCGTGCCATTTGCCATGGGCGAGCCGATGCTGCGGAAGCTGGACCCATACCGCTTCATCGTCTTCCCGCTGTTCC
GTGAGGCGACCAAGTACAAGGATGGGCAGATTGTCAAGGTGGGTGGACCTGCGGCAAAGGTGTGCTTCGATTTAGGAAGA
TGCTGACCGATGCAGGACCTCTCATACCTCAACCGCGACCTTTCCAAGGTGATCATTCTCGACACGGACGCGGGCCACGT
GGCAACACAGCCAGAAAATGCGATCGTGCTGCCCAAGTGGACGGGCGATCCGAAGGACAAGCAGCTGGTGGGCCTGATCC
CGTTTCTAGAGTACATCTTCACGATGAAATACGGCGACGTGCGCAAGGTGCTCAAGTCGTTTGAGGGCACGGACATCCCG
ACGGAGTTTGCGCGGCGCGAGGCGATCGCGCGGGCCGACTTCCAGAAGCAGCTGGAGAGCCACCGCAAGAAGCGGGTGCA
CAAGAGCGAGGGCGGGATCGGCAGCCTCGGCTCGCTGCTGGGCCTGAAGACGAGCAACATGAGCGTGATGGTGCAGCCGG
ACGGCGAGCCAAACCTGGCCGAGCAGCTGGCACAGGGCAAGATGCTGCAGGACATTGCGCGCGAGCAGGGCCAGCGCACA
TACGAGCTGATGGAGAAGGAGATTCGCGAGAACGGCGAAAAGTGGCTGAAGGAGGAGGCCGCCATGCAGGAGAAGATGCA
GCAAGAGGCGATGCAGAACATGAAGCAGTCCTTCAGCGGCTGGTTCGTCCAGCCGTCGAGTCCGGCAGCGGCAGAGGCCC
CAAAGAAGCCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62