GenePrediction:GLEAN_4561 Details

Name: GLEAN_4561
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1938414..1933154 (- strand)
Length: 5261
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1938414..1937421 (- strand)
Length: 994
Type: CDS
Source: GLEAN
Position: GCSC_167:1937362..1937229 (- strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_167:1936495..1935958 (- strand)
Length: 538
Type: CDS
Source: GLEAN
Position: GCSC_167:1935896..1934697 (- strand)
Length: 1200
Type: CDS
Source: GLEAN
Position: GCSC_167:1934629..1934318 (- strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_167:1934265..1934099 (- strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_167:1933819..1933741 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_167:1933398..1933154 (- strand)
Length: 245
>GLEAN_4561 class=GenePrediction position=GCSC_167:1938414..1933154 (- strand)
ATGGCCAATCTCGAGTCTCGCAAACACATCTCGCCCGATTCAGGGTTTCCCATTTCGATCCATCCCCATTTCAACCCCAA
GATCCGTGACTGGACCCCTCCGGAGCCGTTACGAAAAGCGTTCACTCCCGACAAGGACCGGGCGAGCTTTGCTGATCCAG
AAAAGAAGGCACTGTTCTCAGCTGCCAAGGCTGTACATCTGACGGAGTCTCTCGGCACCGTGCTGGAAGGCGTGCAAATC
TCGCAGCTTACACCTCAGCAGCTAGACGAGCTCGCCCTCTTGGTTGCCGAGCGTGGCGTTGTATTTTTTCGAGACCAGGA
CCTTACTACAGAGAAGCAAGTTGAGGTGTTCGAGCACTATGGAATCTTGGACCGCCACCCTGCACAGAGGGACACTAAGC
ACGTTGTTATTCGTGGCAGCCGTGATGATCACCGGGAGATATCCAAGTACACGCCCTGGGGCTCGTCTGAGTGGCATGCC
GACACCTCTTTTGAGCTGAACCCGCCTTCGTACTCAATGTTGCGCATGGAGGAGCACCCGGACGTTGGCGGCGACACCGC
CTGGGTCTCACAGTATGGCCTCTATGACGAGCTCAGCGAAGCGCTGAAGAGATTCGTGGACGAGCTGCATGCCGTGCACA
CTTCTCGGCTGCAGTACGACACCATCCTCGACCTCTGGGGATCGGGACCCAACCGGCCACCGATCGATACGCATCACCCG
GCCGTTCGCACACATCCAGTCACCGGCCTCAAAGCCTTGAATATCAACCTAGGCTTCGTCATCGGTTTTGCCGAGCTGAA
GAAGCCCGAGTCGGACAAGCTTCTCGACTTCTTTGCGGGCCACATCCATTCGGCCGACGACCACTTGGTCCGCTGGAAGT
GGACAGTCGGCAGCGTGGCCATGTGGGACAATCGGTGCACAATCCATCGTGTCATCCCCGGTCGCTACGAGGCGAATCGG
CGCGGCATCCGGACAACTGTGTTTGGCGAGAAGCGTATGTGTTCTCGTTCATATCCATGGTCTGCATGGCGCATTTGCTA
ACGAACCCGCAGCCTTCTTTGACCCGAAAAGCGAGAGCCGATATGAAAGAGAGGACCGGCTAAAGGGTAAGCGGGTGGTC
GAACCAATTGCTCATATCGTCGAGGCGGAAGCGAACAAAGTGGAAATACAATCTGAGAAAAGCAAGGTCAGCAGCACGGC
AGCATAAATCAGGCGATGTGTTTACCTAGTGCAGGGTGGCATGTTTCTCGTCCAATCGCAAGGAGCAGAGATAACCGAGA
AAGCGGCTGTGCAGGCAGAAACAAACCAAAATCCATAACAATGTCTCTGCACAGCCTTTTGTCAGACGTGTTTGTTTTGT
GGTCACCGACCACTCCAATGTTGGGCACAAGGCAGGCTTCTCTGCGGCTATGTATGGCACCGGTTGATAATCGCTGTAGA
TCTGGGGTTCATACGCTAATATCCACGGTTTGGTCGAGATGCCGCCGGCGCAAATCAAGGCACAAATTGCGGGCAGTATC
GGGATAGGCGCTGTAAATTACTGAAAGCAGTCGTGGTTCGGTCTTTGTATCAGCGCTAGAGCTAGCGGGGTACACTACAA
GGCCGAAGGCGGGGCACACGACAGGTCAGACCTGCCTGAGTCTATCGAGAATCAGGCGAATTGAGTGCACTAAACTCAAA
TCACATCGGTGTACCAAACTGCTCCGCCTCACAAGTCAGTCAGCCCAACCTCATTCAAGCATTATCCAGTGATTCGACAA
GGAGGGCGTATATTTGCACATAATAGCCGAGAAGGAACGAGGCACTACACCTCTGAAAAGGACATTTTGGCAAAGCGCTA
TATCCTTTCAAGCAACATCACACCACAACGCAGCAGGACCAAGATGCCGTCCTTTTTTAAATCCAAGTCTAAGGAACAGG
AGGCGGCCAAGGATAAAGCCCACGAGTTGACTTCCTCCTCCGGTGTCCCACCCGCCTATTCTGTTCAGTCGCCCGGGGAC
GACAGCACTGCCGATCCGGGTGACCAGTTGGCTGCCGCGCTGGGAAATTTGAAGCTGTCAAATGTTGTTGGAGATCCAGA
TAACGACAAATGTCTAGCTCACCTTCGCTTCCTCTATGCATTGCACGCACTGAAGGAGGACATTGGCTACACAGATGGCC
TCTGGGGCCTGTGGGATTCGCGTGCCCTTGCAAGCTTTGAGCCAAAGCTGCCGGACGGCCAGCCACAGCCGAAAACAGAA
CAGGAACGGTTGCAGGCCCGACTGAGTCTTGTGAGGGAGAAGAGGTGGTCTCTCTTCGTCACACGGGCAGTTGACCGGTA
CACGGCCTGGTGGAACACGTTTCCAAAGAACATTTTGCAGCAAACGCACATGGGGCAGAAGAAAAGCCCCCATTACAGCA
CCTTTCCCACGGCCAGCGAACCGATGACTTGGAGCCAAGACATGATCCCTCCACTAGGTACGTTGGTGGCGTAGCCTTGG
CGACGTTGTGGTTGCGTGCTGACAGCTATTCCATACAGATGTCATGATGGTATTTCATGCCCATATGCTCAACCCGCGCA
ACTTTCTCGAAGACTGCATGCGCGACGGCCTCAGCGGTCTCTGGGCGGCCGGCTTTCCCTGGGCCATAGTCAACGAATCC
ATTCAGGCCGAGTTTGACTACAGCGTTCCGGACACGACAAAGGAGCGATGGACACAGCTGACGGGCTGCAGCTGGGACAA
CGTGGACGACCCAATGACAAAGGAGCTGAAGTGCCCGGCGTGCCAGCAGAAGGTGATAGTGCCCTGGACAACATGCGGCA
CGGACAAGGACAACCAGAAGAAGAGCGACGAAGACAAGGAGGAAGACCTGGTTGGCACGGGTTACGGCGACGGAAAGTTT
CTCGTCAAATGCATGGTGTGTGAAACCCCGATCGACAACCGGCTGCTCTCGGTCGCCAAGTTTGTGCGAGACGCAAGCGA
CCTCATCCGCAGCGACAAGCCGATGCCAGGCACGGTACTCAAAGCCAATACAGGACAGCCAGAGGACATTGCGGGTAACG
TTGGCGACGATCCACGGACATATCCGAACAAGCTGATCAAGTCGGAGATGCTGGGCTGGACACTGAGCCTGATCCCGGCG
CGGCCGGAGCTGGACGACAAAACTGGCGTAATTAAGCCGCCCCCAACGATGGAGCTTGTGCGCGCCAAGTTTGAGGAGAT
TGTGGAAGATGCCGACAAGCTCTTCAAGTTCGTCGCCGACCGGCGATACCGGCCCAAGAAGCTGTCGCGCGAGTCGCGGC
TGGCAGTGCGTCGGCTGATGAGCCGATATTGGGACAACGTAGGCCCATTTGCGCTCGACCTCGTCGGCGCGGTGTTGCGC
CAGGGCGTCTTTGGCGACAAGATGCGACGCATCGACTGGCTGCACAGCCCGGCGGCCGTTGAGACCATGACCCGGCTCGT
GGTCAAGTACGGCCGCTTCTTCAGCATCATGGCCGAGAACCCGGAGCAGACCTGCGTGCCGACGCTCGACGTCGATCTCG
CCTGGCACACGCACCAGCTCAGCCCGCAGGCCTACTATAAATACAGCCTCCGGCTGACCAAGTACCGGCCTCACCTGAGC
GTGCCGAAGCTCATCGACCACGACGACAAGATCGACGAGGACCGCCTCAACCTCGCCTTTGAGTTCACCAGCAAGATGTA
CCAGCAGCAGTACGACGAGGTCTACAGCGAGTGCACCTGTTGGTACTGTGAATGTTCGTTTCTCTTTCCCGCTCCTTCTC
TTTCTCTCTCCAGACTGACCGTCAGCCATCCGAGCGGCCCACGTCAGCTCAGCCGGCAAGCTCCTCGGCGTCTCCAAGCA
AGACCGCATCGCCGAGACCTTTTACCGATCCGGCCAGGCCCAGTTCTGCCCGCCAGATCGATCTGCCCACATCTCGGCCC
ACAACGCAGTCACCTTTGCTGATACCGTCAGCTCGTCCGTCGCGCGGAAAGCTCATGACGTCCAGATGCGCCGCCTCGAG
CAGAACTACAACAAGGCCGTCAAACGGGCCGAGAAGCGCGGCCGCAAGCTGCCGCCTCGCGACGAGTACTACGACCACTG
GGGCTACGCGTACTTTAGTAAGGCGACCAACTCTCCTGCTGAAACATGCAGACTGCTGACACGTGCCAGTGTACTCTCCC
TACGTCTACCCGGGCTACTTCACTCCCGGAATGTACTACGGTGGCGATCCGGGCTGTGTGCCGACCGGCTCGGGCACCTG
GGGAAGCTGTGCTGGTGGCACCTGTAGCGGTAGTGGCGTTGCAGCTGGCGCTTGCGGTGGACCTGGTGGATGTGGTGTAA
GTATCAGTCCGTCGAATCTCTCATTGCTGCCTCTCGGCTAACTTGTGGCTTTCTAGAATTGCGGCGGTGCTGCGGGAGGT
ACAGGCTGTGCCAGCGGCGGTGGTGGATGTGGGGGTGGTGGATGTGGGGGTGGTGGCGGTGGTGGCGGTGGCTGCGGTGG
AGGTGGAGGTGGTGGTGGTGGCTGTGGTGGTGGAGGAGGAGGAGGATGTAAGTCTTGTTCGGTGGCCCCATGTCGAACAG
CTCCCTAATACCAGCATTGCTAACCATGCGCACAGGTTAACTCATGTGGCGGACATCCAGCCACAACTACGGAGCAGCCA
GACTTTGATCTTTCGGTCGATATTTCTGTCGTTGGTTTAGTCTATATCCAACTCTACAACTGAATGTATCCCGGTGGTTG
ATATAATTTATTACGTCGCATCCTTCAGACCAAACTACATTTAGCAGATATCGAATTGTGCTTTTACCGCTGATTTGTAT
GAAAATTTACATGTATTTCAATAAAGGGTTTCCTTACCGTATTTTTCGTGGTTCGAACAAGACACAAACAGTTTCATTAA
GTCAACGACTGCAGCCTAGCAGCCGCTAGTATGAAACAGTATATCACCAATTCGGCTGTGGCTTGATGCTTTCCACTGGC
ACGGGCAACTATCTCTGCACGCAGTGAGAAAGTGACTGCTCCTACCACATATTTAGCTGTGACCGTCCCAGAGGGATTTT
GTGACGGCTCTATCGGTCTCGAGGATGTCGAGGCCACGCACTGCGTCTTGCTCTCGGCCTGCTTCTACGCCGACTGGTCG
AGGCCCCCCATGAACCTCACCCATCACGTGACTGACTTCCGCAGCGGCCGCTGTACTCCCACCTTCCGACTCACTGAACT
GGAAGCCTGTTCAGGGCACGATCGTGTCCGGCAATGCAACCTACATGGTCATACGCAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62