GenePrediction:GLEAN_4562 Details

Name: GLEAN_4562
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1926139..1924017 (- strand)
Length: 2123
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1926139..1925958 (- strand)
Length: 182
Type: CDS
Source: GLEAN
Position: GCSC_167:1925646..1925013 (- strand)
Length: 634
Type: CDS
Source: GLEAN
Position: GCSC_167:1924934..1924017 (- strand)
Length: 918
>GLEAN_4562 class=GenePrediction position=GCSC_167:1926139..1924017 (- strand)
ATGTCGAGCCGCGACCAGATCCTGTCGCCACGAGCGGTCGAGGGCATGATTGCAGACGGTGGCATTATTGTCATCTTCGA
AGATTACGTCCTGCGACTCGACTCGTGGGCCGACAAACATCCTGGTGGCCGTCTGGCGATCCAGCACGTTGTTGGCAAAG
ATGCAACCGACGAAATCATGGCGTAAATAATTTCCACAAAATCTCACATCCTCGTGCCCTTACCCAATTGAGCCCCATTC
CGTCGCTGTCGCTGCACTGCCCAAGATGAGATTGAGAACAAAGACAAAAGCAAAAGGGAGGTAGGACGGGAGGGACCATT
TTGACTAGGTAGGAACTGTGCACTGCGATTAAGTTTCAAGATCCACGGCAACAGCCGTGACAAGTCATTGAATGTCCTCC
CCCTAGCTTTCTAGCCGCTTTCCTTTTTTGCCCATCCTGTGCCTGAATAAGACGAGGTACATTTTGAATGGGGTGCTGAC
ACTAAATCTGCAGGTACCATTTTGCTGGGACAATCAGCACGATGAAAGCCTACCGGATAGGCCGGAAGCCAATGGGACCC
TGGGCCAACATGACACCACCAATAAGAGGAGGCATCTACCGCCGGCCCAGCATCTCACTAGGCGATGACAGTCCCACCCT
CCACGTTCTCGATGCGGCTCTATCCGATGACGGTGCATCCACTGGGTGTGACCACGTCATTGACCTCAGTCCCTGTCTTG
CCCGTAAGCCTGTCGCGGCTATTCGGAGCCCCGGCACGCCCGATCCCGAAAAGGTAGCCGGCCTTGACGATGCCGACGAA
AAGACCGGTCTGCTCGCTGGCGGTGGGAGGGCGGGAGACATCCCCACCATCCTTATGACGCCTGAGAAATACACCGACTG
GGCCGTGCAGCAAGAGATCGAACAGGGCCTCCGCGACTACCCGTCTCTAGACCCCCTGGTGCAGCAGGACATTGTGCGCA
AATACCGGCTCATGCACCAACAGGTCATCGACGAGGGCCTCTACGAGTGCAGGTACATCGAATACGGCAAAGAAATGGTC
CGGTACACCAGTCTGTTCGCTCTCTTCCTCGTTGCCCTGCACTACAGCTGGTACATAACCTCTGCTGTCTTCCTGGGACT
TTTTTGGGTAGGTTCTCTCCATTTCACCTTTCGCCTTCCTTGCTCGCTTCCCGTTTCAGGTGGATATTGACCTCGTATTC
AACAGCACCAAATTATGTTTACTGCGCACGATGCTGGACACCGAGCAATCACCCAGAATTTTGTCGTTGACACGTTGATC
GGCCTCTTTGTCGCTGACTTCTGCTGCGGGCTGTCCATCGGCTGGTGGAAGCGCAGCCATAACGTCCATCATCTCATCAC
GAACCACCCGGAACACGATCCGGACATCCAGAACGTGCCGCTTTTTGCCACCTGCCCATCGTTCTTCAGGTCCGTCTACT
CGACATACTACGACTTCACATTTGCCTGGGATGCCGTGGCCAACTTCTTGGTCCCGTACCAGAGCTACACGTACTATCCC
ATCATGGGCGTTGCTCGTTTCAATCTCTACTTTCTCTCCTGGCTGCACGTCCTGTCGTCCAAGGCATCTGCGCTCGGCAA
CACCAAGGCCTGGTGGATTCGGTGGACCGAGATCGTCTTCATGACCTGCTTCTGGTTCCTCTTTGGCTACTGCTTGGTGT
GGCGCACGCTGCCGAACTGGCCGGTCCGCGTTGCCTTCGTTCTCGTCTCGCACATAGTTACTATGCCGTTGCACATTCAG
ATCACGCTGTCCCACTGGGGTATGTCGACATCTGAGCTCGGCGAGTCTGAGTCCTTTGCCCAGCGCCAGCTGCGCACCAC
CATGGACGTCGACTGCCCGGCCTGGCTCGATTTTATCCACGGTGGCCTGCAGTTCCAGGCTGTTCACCATCTGTTTCCCC
GCGTGCCGCGCCACAACCTGCGCCGCGTGCAGGAGCTCGGCCTGGCCTTCTCGCGCGAGACTGGCGTTCCTTACACCATC
TTCAACTTTGTTGACGGCAACCGCAAGGTGATCGACCGCCTTGGCGAGGTGGGCGACCAGGTCCGCATCCTGGTCCAATG
TCAAAAGTACATGGCCGAAACCCGCACGAGCGGCTTGCATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62