GenePrediction:GLEAN_4565 Details

Name: GLEAN_4565
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1918723..1917567 (- strand)
Length: 1157
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1918723..1918525 (- strand)
Length: 199
Type: CDS
Source: GLEAN
Position: GCSC_167:1918471..1917804 (- strand)
Length: 668
Type: CDS
Source: GLEAN
Position: GCSC_167:1917743..1917567 (- strand)
Length: 177
>GLEAN_4565 class=GenePrediction position=GCSC_167:1918723..1917567 (- strand)
ATGGCAATCAGTAGCAAGGCAAACGTGCTTCTGGTGGGAAGCGGAGGCGTCGGGACGATGGGCGCCTACGCGCTCGAATC
GGGAGGCCTGGCCGAAGTCACGGCTGTGCTGCGGTCCAACTTCAGCACGGTCAGCGAAAAGGGCTTCGATATCTCGTCGA
TCGACCACGGCGAGGTGAAGGCGTGGAAGCCGAAAAAGAGTGGGTGTCGAGCCAGTTCCGCCGGCCGTGAGCCACAACGC
TAACTTGAGCAGTCGTCAGCCAGGTCCCAGACGTGTCGGATGAGGGTGTTGTCCCATTTGACTTTGTGGTGGTGTCGACG
AAGAACGTAGCGGACGTGTCGCCGACGGTGGTGGACATTATCGCGCCAGCCGTGACGGCTGGCCACACGGCCATTGTGCT
GCTGCAGAACGGACTGAACATCGAGGTGCCGGTGATCGCGGCATTTCCGCAAAATGTCGTCATCTCGGGCGTTTCGCGCA
TCGGCGCGGCCGAGACGAGTCACGGCGTGATCGTGCACAACGACCGGGACCGGCTGCACATTGGCCCGTTTGACAACGCG
AACCTGCCGGCGGAGCTGCAGACGGCCACGGCGCAACGATTTGCCACCATGTACGGGGCCTCGGGCAAGGTGGTGGTGGA
GTTTGGCGCGACAGCGCAAGAGGTCGCCTGGACGCGGTGGCGGAAGCTGATCTACAATGCCTGCTACAACTCGATTGCGG
CCGTGACGCTGCTGGACTCGGGGCGTCTCCGCCTGGCCCGGTCGCCCGTCGTGGAGCTGCTGCGACCGGCTATGCTGGAG
ATTGTGGCCATTGCCAAGGCCCAGGGCCATGTGCTGCCGTTGGAACTCGTCGAAGAGATCATCGAGGCTGAGCCGATCGA
GATCTACTTCAAGCCGAGCATGCAGCAAGACGTGGAAAAGGTGACGAGTGCAGGTGGGTGGCGCAATCGGTCGTGTCGGT
TGCTAACTGTCTGACTGTAGGGAAACTATACCGAGTTTGAGAACATTGTGGGCGAGCCACTTCGGACGGCTCGGAAGCTC
GGCGTTCCTGCGCCGACTTTGACGGTTCTGTATGGGATCCTGCGGGCTATGCAATGGCGCACAAAGGAGCAGAAGGGCTT
GATTACTTTAGAGTCCGCCCGAGCCCAATTGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62