GenePrediction:GLEAN_4566 Details

Name: GLEAN_4566
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1917250..1916568 (- strand)
Length: 683
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1917250..1916684 (- strand)
Length: 567
Type: CDS
Source: GLEAN
Position: GCSC_167:1916630..1916568 (- strand)
Length: 63
>GLEAN_4566 class=GenePrediction position=GCSC_167:1917250..1916568 (- strand)
ATGTCTGTCCAGACTATACGCTCTATTCTCGGTGCGCCCTCAACGCCACCGACGATCGATGACTCGATTCTCCTCATCAT
TGACGCCCAGAACGAGTATGCCGCCGGCCTTTTGAAGGTTGCCCGTCTAGAAGAGACCAACACGGCCATCAAGGCGCTGC
TGAACCGCTACCGTAAGGCTGGCAGCAGCGTCATCCACGTCGTCATGGACGTGCCTGAGGGAGCACCCATCTTCACGCCC
GGCACGCCTCTAGCTGCGATCCTAGACGGGCTTGAGCCGGCCGAGGACGAGCAGGTGGTGCATAAGACCCACGCAAGCGC
TTTTACCGGCACTAACCTGCAGGAGCTTCTGGTAAAGACAGGCAAGAAGAAGCTGTCTGTCGTCGGTAGGGTGCCACTCC
ACTGTCCATACTGGACATCCAGTGCTGACAGCCCAGGCTACATGGCCCACAACTGTGTGTCTGCCACGATTCGCGTGGCT
GCCGAGCTTGGATACGACGTCTACGCCGTCCGTGATGCCATTGGCGACCGTGACATTCCCGGTGCCACGGCTGAGGAGCT
TGTTCGGGTACGTTATCCCTCTTGCCGTTAGAAGCATACTTTTCAGCTGACAGACCGCAGGTTTCTCTTGCCGAGGTGGC
AGATGTTGTGTCTGTCATCGTCGAGTCCAAGGACATCCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62