GenePrediction:GLEAN_4567 Details

Name: GLEAN_4567
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1892953..1888173 (- strand)
Length: 4781
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1892953..1892681 (- strand)
Length: 273
Type: CDS
Source: GLEAN
Position: GCSC_167:1892629..1891007 (- strand)
Length: 1623
Type: CDS
Source: GLEAN
Position: GCSC_167:1890947..1890144 (- strand)
Length: 804
Type: CDS
Source: GLEAN
Position: GCSC_167:1890062..1888173 (- strand)
Length: 1890
>GLEAN_4567 class=GenePrediction position=GCSC_167:1892953..1888173 (- strand)
ATGGACAATGCAGACTCTCAGCAGGACCTCTCGATGGCCGAGATGTGGCAAGAGGCTGCAGTCAGGTTCAAGGAACGGAC
CGGGACGACGTTAAGCCTGAAGCCTGCAAAAACGCTGGACGATTGTATTGCAGAGATCGAGAAGCGCCAGCTGCCGGCGC
CGTCGTTGTCGACAGAGACGGTATCGACAAGAGACAAGGCCAAGCAGTATGGAATCAACATTCTGCGGTGTCTGAAACTG
CTGGGCGGAGTGGCTGCAGAAGGGGCAGAGATGGTACGTTGGAGCCTCTTATGCGCTCGTCCATTGTGACTAAGGTGATG
CCAGGTATTTGCGCCGTCGAGCCTCTGCTTCAATGCGCTGTCGCTTCTTCTGGACGTGCCAGAGAACATCCAGGACTTCC
ACAGTGCGGTGGACGGCCTGTTCGAGACGCTTGGTCCAAGTCTCGGCGTCTTCAGGATATACGAGAGGATCGAACAGTTC
AAGAACATCGAGCCTGAGCTGAAGCAGGCCATCCAGCGGGTGATGATCAGCTTCATTGACATATGCGCGCTCTACATCAA
GCTGCGTAACTCGGGGAGGTGGCGCAAGTTCAAGGCCGCGACGAAGCTCATCCTCCTAGACGACGACTCCGGCGTCAAGA
GTGAGGTTGAGCACTTCAAGACGCTGACAGCAGCACATGGTTCGGTGCAGGCAACGCAAACGCTCAAGACGGTGCTAGAG
AGCAATAGCAGCCTCACGGCCTTTCTGACGGAAGCATCCGAGACGGGCAGACGTATAGAAGAGATGGCCGTCTACGTGAT
CGGTCTTCGGGACGCAGACGACAAGCGGAAGTCGGAGGAGACAAGGCGGAAGCACCTGGTCAACATACGAGACAAGCTTG
GCATACAGGAAAAGGCACTGAAGGCGTCGAAGGAGGCCTACGACGAGCTCTGGCATATCTGTGTCCCTGGCACGGGCAGC
TGGATGGTGAATGCGGACGGAAATCCGGCATTTCGCGAGTGGGCCGAGCGAAACAATGCAGAGGCGAAGCCGATGTTCCT
GCTGAACGGCGATCCCAACACGGGCAAGTCGGTCGTCATGTCGTCCATCAGCCACCACCTGCGATCGATCTACGAGGCGC
CGGACAGACAATCGCCTCGAACCCTGGTCGCATCCTACTTCTTCCCCAGCTTCACGGGCAAGAGTGACGAGGACCGGCGA
CCGGTAGAGACGGCGCTGAAGTGCATCGCGATGCAGCTGGCCGAGCAGGACGGTGTCTGTGCCAGGAAGATGTCGCAGGC
GTGTGACGGCCGGACCGATGCCGAGACGTTCTTCCATGACGCCACCTGTGAGGGCCTCTGGGACCTGATCAGCGCGTGCG
TGCCGAGGGCCAAGACGACGGCACACTTTCTGCTTTTAGACGGACTAGGCTCGTTGCCGAGTGGACAGCGGGCCACGATG
GAGATGCTGTTTGCCATCTTGGACCGGCTGGATTCAGAACAATCACCCATACGAGTGCTCCTGTCAGTCAGGCCGGACAG
TCTTGCGACCATGGGTGCGTGCAAATGGCCAAAGATCGACATGGAGAAGCACAATGCCGAGGACATTCGCAGGTACATCG
ACCACGAGCTCAAGGCCAAGGACATGTTCCAGGACGCCGACGACAGCTCGGTCAGGATTGGGACGCGGATCCGAGACCGG
CTGGCCAACGAGGTGGGTGGCAGCTACTACAAGGTGACGTCTGCCATTGGCAAGATCGAGGAGGTGGTGCTCAACGACGG
CGAGGAGACTGATGTGGACCGGGTGCTCGACGAGTCGAGCAAGGATGAGAGGGCCATCTCGCAGACGGTCATCCGCACGC
TGGAAGAGACGCTGCAGGCGCGCGAGATCGCCGAGCTCAACGAGCTTCTCGTCTGGGTCATCTTTGGCTTCTGCACATTC
CATCTCGACCTGTTGGATGCCGCGCTGGTGAGTTCCGTCCGACTCAGACGATGCTGTGTTGACTTTGGCTGACTGATCGT
CTCTAGTCTCTCCGGTTCAAGACACGGACCCTGCTCAAGCTGACGAACAAGTTGAAGGGAAAATACGGCAAGATCTTCCA
CGTGCTGTCCGACGGTTACGTCGACATTGCCGAAGACATGGAGGCCAACCTGCAGAAGGAGAGGACGCAGTCACGGGTGG
TGGATGAGGCGCCCACGTTCTCGGCCACCATCACCATCGCCAAGGCTGACCTCACAAGTGTGCAGTCGTTTCTCTGGAGC
TTCATGCAAAAGGCCAACCAGGACACCTTGGGCTTCCAGCAGCTGACCGACCAGACCGGTATCAAGGGCACCATCGGGGT
CAACCGCTTCGACGCCCACCTCAGCATTGTCCAGCAGACATTTTCCATCCTGGCCGAGGCGCCGGACCTGAGGACACGGC
CGCTGGCGTCATACCTCCTCAACTATCTGCCTCAGCACCTGGAGGTCCTGGAGGAGGCGACGGGCATCGATGCGCTGACG
CCGGCGGAGAAGCAGATGGTCGGCGAAGGTCTCTTCTCGCTCGTCGTATCTGGCGAGGTCATTGAGAGGCACTGGGGCAG
CTGCGACGCTCTCGTTTGGTTCCGCGAAGATGACGAGGTTCGGGTATTTCGGCGCTGGCTCGCCGACCCGTCCGTCACCT
CGCGCCTCGGCCGACTGGACCGCGAATGGCTCAGGGATGTCGAGGCCGACCAGAGACCAAACCGAGCACTTCTGGCGAAG
CTGGCCAAGACGGTGGCACGACACTGGCTGCGAGACACCGACTGGGAGGTGCGCATTTCGTACGAGTGGCTGCGCGGCCT
TTTGATGTTGGTAAGTTTTTATTTTGTTCTTTTTTTATTTGCTTTTTTTGAAAAAAAAAATACCGGCAGGGGCATATTGC
TGACCGTTCAGTCGGGAGCACCGGAAAGCACCGAAAGGCCAAGTGACACGCCTGATAGCTCAAAAAGTTCCGAGGCAGTC
GCTGAGTCAGTCACCGAAATAACGGTCGAGTCGGCTGCCGACTGGTGCCGACAAGTCCTTGTCGTTTCCGAGCTGGACTC
TCTCTGGTACAGACGCCTTGGCGAGACGTTCTACGAGGTCCAAGGACCGGGACTAGCAGTCGATGCATTCCACTCAGCTC
TCAGCCTCGGCGACGCGAGCGCGGAAGTTTACGAGGGATTGGCAAAGGCGTTGGCAATGCAGGGAAAACTGCCAGAGGCG
TGTGACCGTGTAAATGAGGCTTTGAAGCTGCTCGACGAAGACGATGGGGTGAACAGGCCGATTCTGATCCGCATCTATAC
GCATCTTTCGACGTGGTACACCTCGTTGAACGAGCCCAAGCGTGCGGCCGAGTACATGAAAAAGGTGATTGGTCTTTCTC
CAGACGATCACGCCTCATGCTATGCTCTCCTGAAGCTCCATCTGATGTCGGATGACGGCAGTCATGCAGCCGAGTTCCTG
GAGGACCTGACCGGCGCCTCAGATGTGCAAGATGAGCCAGGCCGCTTTGGCAACATTGTCAGCGACATGTTTGGGGACTG
GCAGCACGAGACGGTGCTTCCGAAGCTCTTCACGGCGATTTCCGAGAACAGCAACCTGTTCGCGCGCATTCTGCAAGAGC
TGGACCGCGCCATCGCCAGGGCACAAAAGGCCGAGGATCTTCCGACCATGGCCGAGATGCTGCTCTACAAGGGCGCTGCG
ATCTACCACTACAGCAACGACACGGCATCGGCCACGTCAGCCATTGCCTGCTGGAGCAAGTGCCTCGACGTCAAGATCGA
CTCGGACTGGTCGTCCAACTACAGCACAGCCTCCCGACTGTTGAGTGCCTACCACTTTGACCGGGCGAGAGCGTCAGACG
AGACGGCCGTGCGGCAGAAAGATGTCGAGCGGCTGAAGCACCTGCAGACGGCCGAAACCCGCAGCAGGCTCTTTTCCATG
TCGGCAGCCAAGGCGTATCTTGCGTCTTACTACACCATCAACCGAGAGTGGACAAGCGCCCGAACTGTGGTCAAGGGATG
TCTCTATTCTGCCTTTGACCTTCTCTCCGACGACACGGAAGAGAATGACTCGGACGCCATCTACATGATCGCCTGTATCC
TGATGCACTGCGGCGACGAGCGCAATGCCATCTCGGCCTTCTCGATGCTGCCTCCACGACCAGACAAGGGAAACGTCCTG
GCCTGGCTGCTCGATTTCGAAGAGGACCCGGCACGCGACGCAAGCCTTGGTCTGATCAGGGCCATAGAGGAGGAGGACAA
TTCATCATCTCTGAACAAGCAGATCGATTTGGCTCTCGGCCTCGTGGGGAAGCGGATTAGAGTAGGTGCAGACGCCACAC
TTGTCGGCGTGTACGAAGAAATCCAGGCGAGACTGCGCCAGGTCACTGTGAGCAAAAATCTCGGCAGTCTCGGCTATTGG
TGCGATGGGCCATGTGGCAGGAAATGGGACTTTGAGAATGCGATGCACGCCTGCAAATTCTGCTACGACCGCGGCTTCTG
TGACCAATGTCTCGAGATGCTGCAGCAGGGACAGCTCAAGAGCCCGACCGTCTCCGGACTCGTGTGCAACAAGAGCCACG
AATGGCTTCTCCTGCCCAAGTGGGACAAGCAACGCACTCTAGATGTGGTCAGCGGAAACACACGGACCGGCGGCCAGTTC
GAAGGGGGAGTGTGTGTCGGCGGAGAGGCTGTGTCTACAAAGACCTGGCTGGCAGACCTGAAGCGCGAATGGGGATACGT
AGAGAATGACAAGTCCGTCGACGGACAGGAGGATATGGGTGGAGCCGACAAGTCGACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62