GenePrediction:GLEAN_456 Details

Name: GLEAN_456
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1882846..1883565 (+ strand)
Length: 720
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1882846..1883308 (+ strand)
Length: 463
Type: CDS
Source: GLEAN
Position: GCSC_167:1883363..1883565 (+ strand)
Length: 203
>GLEAN_456 class=GenePrediction position=GCSC_167:1882846..1883565 (+ strand)
ATGGCGACAAATGACGGAGGAGAACGGCGAGCGACAGAGGCCAGCACCGCTGCGGCTGCTGCGGCTGCACCAAAGACTGC
GTGGGACGATGCGGCCTGGGCCCAGTCCCGCCTCTCCCTGCCAGATCCCATTCGCATTCCTCTCGCGGCCACGGCAGCCT
TTGCGGTCGGCATGGGTCTCGGGGCAGCGCAGGGCAGCACGATGGCTGGGATGCGGTTCCGTGCAGAGCACGCGCACAAG
CTTCCGCAGACGACGACCGGCTGGTACCTCTACCACAAGTCCAAGAACTACCACGTGGCCCACGGCGGCATCCGTGAGGG
TCTGAAGATGGGCGCCCGCGTGACGGTCTGGACGACGGCCATGTTCGCGATCGAGACGCTGTTCGACAAGTACCGCGGCC
AGATGGACCTGGCCAACACCGTTCTCGCCAGCGTCACCGTTGCCGGTGGCTTTAGCTTGTGGAGTAAGCTGGCCGTCTGG
AGCATCGTGCCATGAACGGATTGTTAACCCCAAACAGACCGGTTCCCTCTGGCCACGGCTGCACGCACGACGAAGACGGC
TCTGCTTGTGGGGCTGGCCTATGGAGGCGTGCAGGACCTCGCCAGCGTCCTGAGAGGCCGACCTGTCAGCTATGTCGACT
TTGTCAAGAAGAGATTCCGTCGCGCCGGAGCCGGAGACGTGGCGCCACCAGCAGATAGCCAACAAGAGCACTCGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62